Previously, we classified three factors (OmpR, RstA and IHF) as a

Previously, we classified three factors (OmpR, RstA and IHF) as activators and two factors (CpxR and H-NS) as repressors, and found novel modes of their interplay. Here we describe an as yet uncharacterized regulator, MlrA, that has been suggested to participate in control of curli formation. Based on both in vivo and in vitro analyses, we identified MlrA as a positive factor of the csgD promoter by directly binding to its upstream region (−113 to −146) with a palindromic sequence

of AAAATTGTACA(12N)TGTACAATTTT between the binding sites of two activators, IHF and OmpR. The possible interplay between three activators was analysed in detail. Under stressful conditions in nature, planktonic single-cell Escherichia coli transforms into multicellular biofilm through adhesion to solid surfaces and cell–cell interactions using extracellular matrix compounds FDA approved drug high throughput screening such as cellulose and curli fimbriae (Prigent-Combaret find more et al., 2000; Chapman et al., 2002; Beloin et al., 2008; Gualdi et al., 2008; Wood, 2009). The synthesis of csgBA-encoded curli is induced at low temperatures and

under low osmolarity during stationary phase growth (Barnhart & Chapman, 2006). Expression of csgBA is under the control of a positive regulator, CsgD, which is also involved in the regulation of cellulose production and peptidase synthesis (Prigent-Combaret et al., 2001; Brombacher et al., 2003, 2006; Chirwa & Herrington, 2003; Gerstel & Romling,

2003). In concert with the regulatory role of CsgD as the master regulator of biofilm formation under stressful conditions, the major sigma RpoD and stationary phase-specific RpoS participate in transcription initiation from two promoters of the csgD operon (Robbe-Saule et al., 2006; Gualdi et al., 2007; Ogasawara et al., 2007a, 2010). Furthermore, a number of transcription factors are involved in the regulation of the csgD promoter, including CpxR (Jubelin et al., 2005), Crl (Bougdour et al., 2004), H-NS (Gerstel et al., 2003), IHF (Gerstel et al., 2003, 2006), OmpR (Vidal et al., 1998; Gerstel et al., 2003, 2006), RstA (Ogasawara et al., 2007a), MlrA (Brown et al., 2001), RcsB (Ferrieres & Clarke, 2003; Vianney et al., heptaminol 2005) and CRP (Zheng et al., 2004). On the basis of these observations, the csgD promoter is now recognized as one of the most complex promoters in E. coli (Ishihama, 2010). As an initial step toward understanding the regulatory mechanisms of the csgD promoter by a number of transcription factors, we have classified some of these transcription factors into positive and negative regulators (Ogasawara et al., 2010). In addition, we and others have analysed the pair-wise interplay between RpoS and Crl (Robbe-Saule et al., 2006), IHF and H-NS (Gerstel et al., 2003; Ogasawara et al., 2010), OmpR and IHF (Gerstel et al.

The pulvinar neurons displayed a broad distribution of response l

The pulvinar neurons displayed a broad distribution of response latencies, ranging from 30 to 500 ms. The mean latency of the short latency group was 63.38 ± 1.89 ms, which was comparable to previous studies (Felsten et al., 1983; Benevento & Port, 1995). Because the mean latency in V1, which projects to the pulvinar, is 66 ± 10.7 ms (Schmolesky et al.,

1998), some pulvinar neurons with short latencies, especially those with latencies < 60 ms, might receive inputs from the superior colliculus or directly from the retina. The remaining pulvinar neurons in the short latency group with latencies > 66 ms might receive inputs from the various visual cortices. LY2606368 nmr In comparison, the pulvinar neurons in the long latency group might receive inputs from some other structures, such as the temporal association cortices, prefrontal cortex or the amygdala, which project to the pulvinar (Shipp, 2003). In addition, response latencies to frontal faces were significantly lower than those to profile faces. This suggests that the subcortical visual pathway might be tuned better to frontal faces than to profile faces. Total luminance of the face-like patterns was smaller than those of the square and eye-like stimuli, and luminance of the white

areas of the face-like patterns was the same as that of Gamma-secretase inhibitor the simple geometric patterns, indicating that specific early responses to the face-like patterns are not due to differences in total luminance or luminance. Furthermore, scrambling of the images greatly reduced the pulvinar

responses in the present study. This is the first evidence that pulvinar neuronal responses are dependent on coherent facial patterns. The results also indicate that selective responses to some visual stimuli are attributable to factors other than luminance differences. These findings are consistent with previous studies on face neurons in the prefrontal cortex (Ó Scalaidhe et al., 1999), inferotemporal cortex (Desimone et al., 1984) and superior temporal cortex (Bruce et al., 1981). However, in contrast to these cortical facial areas and the amygdala (Tazumi et al., 2010), the responses of the pulvinar neurons were not specific 4��8C to faces; pulvinar neurons also responded to other visual stimuli, such as simple geometric patterns, in the present study. Furthermore, although there was no significant difference in mean response magnitude toward faces with direct and averted gazes, many individual pulvinar neurons differentially responded to gaze directions (i.e. gaze-differential neurons). Neurophysiological and human imaging studies have shown that the amygdala responds stronger to faces with direct gaze (Kawashima et al., 1999; Wicker et al., 2003; Sato et al., 2004; Tazumi et al., 2010). These findings suggest that the pulvinar sends information on gaze direction to higher upstream brain areas in the visual pathway, such as the amygdala (Tazumi et al.

This study aims to explore the opinions of nurses and carers with

This study aims to explore the opinions of nurses and carers within care homes on the relevance and acceptability of individualised medication administration guides for patients with dysphagia (PWD). 72 Care homes with nursing in East Anglia were invited to take part in this research and a purposively selected sample of 11 were accepted. Participant staff who administered medication to

(PWD) in care homes was included and 15 semi structured interviews with nurses and carers conducted by a research pharmacist specialising in the administration of medication to PWD. A semi-structured question list was used to identify the profession- and experience-based selleck products opinions of the participants

on whether and how far they found the I-MAG useful and their reasons for their responses. The interviews were coded and analysed. The thematic analysis drew on grounded theory principles and theory generated was then applied to improve content and procedures relating to I-MAGs. Thematic analysis indicated ways in which the I-MAGs could help standardise current practice in the administration of medication to PWD. Aspects of using the guides was also seen as increasing the nurses’ clinical confidence in their practice in ways which could improve the care received by PWD by decreasing the medicines administration error rate. I-MAGs are likely to optimise the time involved in the drug rounds but they would require regular BYL719 clinical trial updates from the community pharmacist. Pharmacist-led training on the use of the guides would also be expected by the participants before implementing such guides. The implementation of I-MAGs in care homes by community pharmacists is a complex intervention

that would also involve other healthcare professionals such us Speech and Language therapists and GPs as well as the care Interleukin-3 receptor home nurses. These guides offer an opportunity for community pharmacist to enhance their role in the care homes and to improve communication between healthcare professionals. Although patients with swallowing difficulties may benefit from this intervention, appropriate health outcome measures to determine this should be identified. This study is limited to the views of our participants and further research is needed to examine the effects of implementing the I-MAG and its acceptability by other healthcare professionals. 1. Wright D. Medication administration in nursing homes. Nursing standard. 2002; 16: 33–38. 2. Serrano Santos JM, Poland F, Kelly J, Wright D. Drug administration guides in dysphagia. Nursing Times. 2012; 108: 15–17.

aeruginosa, because functional analysis of VP1701, which is homol

aeruginosa, because functional analysis of VP1701, which is homologous to ExsC, is lacking and there is no ExsE homologue in the T3SS1 region. Alectinib chemical structure Here, we demonstrate that vp1701 and vp1702 are functional orthologues of exsC and exsE, respectively, of P. aeruginosa. VP1701 was required for the production of T3SS1-related proteins. VP1702 was a negative regulator for T3SS1-related protein production and was secreted

by T3SS1. We also found that H-NS represses T3SS1-related gene expression by suppressing exsA gene expression. These findings indicate that the transcription of V. parahaemolyticus T3SS1 genes is regulated by a dual regulatory system consisting of the ExsACDE regulatory cascade and H-NS. Vibrio parahaemolyticus, one of the human pathogenic vibrios, causes seafood-associated gastroenteritis (Honda & Iida, 1993). Although this microorganism is better known for causing gastroenteritis, it may also cause wound infection and septicemia (Ryan, 1976; Mertens et al., 1979; Daniels et al., 2000). It has been reported that clinical isolates of this organism have two sets of genes for separate type III secretion systems (T3SSs) on chromosomes 1 and 2 (T3SS1 and T3SS2, respectively) (Makino et al., 2003). A functional analysis of T3SS1 revealed that it predominantly contributes to V. parahaemolyticus-induced cytotoxicity in vitro and is involved MI-503 in lethal activity in a murine infection model in vivo (Ono et al.,

2006; Hiyoshi et al., 2010). These results implicate T3SS1 in V. parahaemolyticus-induced septicemia in humans. The T3SS1 gene cluster of V. parahaemolyticus is composed of 42 genes, of which 30 genes are similar to those of the T3SS gene apparatus of Yersinia sp. and Pseudomonas aeruginosa (Makino et al., 2003; Park et al., 2004; Ono et al., 2006). In the middle

region of the T3SS1 gene cluster, there are 12 coding sequences (CDSs), which may encode effector proteins and their chaperones (Ono et al., 2006; Casselli et al., Sunitinib mouse 2008; Akeda et al., 2009). At the terminus region of the T3SS1 gene cluster, there are three genes, VP1698, VP1699 and VP1701, that share sequence similarities with P. aeruginosa T3SS regulatory proteins ExsD (22% identity, 40% similarity), ExsA (45% identity, 64% similarity) and ExsC (32% identity, 48% similarity), respectively (Fig. 1a). The expression of P. aeruginosa T3SS is highly regulated and is induced by contact with host cells and low Ca2+ concentrations (Iglewski et al., 1978; Frank, 1997; Vallis et al., 1999). Transcription of the genes in the P. aeruginosa T3SS gene cluster is controlled by a regulatory cascade involving three interacting proteins (ExsC, ExsD and ExsE) that regulate ExsA transcriptional activity (Yahr & Wolfgang, 2006). ExsA is a member of the AraC family of transcriptional activators, and is a positive transcription activator required for the expression of all T3SS genes (Frank et al.

Most literature focuses on

Most literature focuses on Alectinib exploring pharmacists’ views and opinions of specific ethical dilemmas1 rather

than the decision-making process itself. Others have investigated factors influencing clinical decisions such as the sale of over-the-counter medication2. The aim of this study is to investigate the decision-making process of pharmacists and the factors influencing this process. Semi-structured qualitative interviews were used to identify the views of sixteen community pharmacists from a variety of backgrounds during February and March 2013. The average interview lasted for 33 minutes (range 9–90 minutes), and aimed to understand how pharmacists made decisions using a set of three practice-based hypothetical scenarios: supply of EHC to a minor, a confidentiality dilemma and a serious prescribing error. Interviews were audio recorded, transcribed verbatim, and thematically analysed. The study was given ethical approval by a senior academic in the University of Nottingham, Division of Social Research in Medicines

and Health. Pharmacists reported a number of different methods to make decisions. Some reported starting by considering relevant facts and then progressed to a decision. Pharmacist 5 reported ‘but it’s usually a question of looking at selleck chemicals the facts, if it’s a professional decision thinking about the ethics, the legislation, the regulations, commercial aspects so basically put it all into a cooking pot …’ Others reported they made decisions by developing a range of options and then evaluating potential consequences allowing them to choose the least-worst option, ‘first of all I think about all the different options available … I try to put the patient first, but my main criteria is click here “would it get me into trouble”.’ (P16) Acting in the patients’ best interests was the most common theme regarding

influencing factors. Others included personal views and relationships with both patients and other healthcare professionals. One pharmacist said, ‘… but the focus … is always putting the patient first, making decisions in the best interests of the patient … taking on board all the information that I have …’ (P15). Another commented on their relationship with their GP, ‘I think it does affect my decision making because I like to make life easy for my GPs, because in making life easy for my GPs they respect me more and rely on me more and appreciate me more, … when I’m thinking about how to resolve problems I also think well what would my GPs like me to do, how do I make it easy for them and the patient’ (P8). Previous experiences were also reported as important, ‘It’s usually based on previous experience with regard to how that situation fits in initially with the law, with the code of ethics and patient’s needs …’ (P6). This study suggests that pharmacists employ a range of methods to make decisions.

The majority of women (63%) were diagnosed with HIV infection thr

The majority of women (63%) were diagnosed with HIV infection through routine antenatal screening. A history of sexual abuse was reported by 45% of patients (18 of 40). Housing and financial problems were reported by over half of the group [58% (36 of 62) and 62% (34 of 55), respectively].

Over half of the patients were unemployed. Of 23 students, six were of compulsory schooling age at conception. An STI screen in the 12-month period pre-conception was documented in 92% of women (33 of 36) and there were no data for 46% (31 of 67). A history of STIs was reported by 43% of women (20 of 46), with no documentation in 31% (21 of Alvelestat clinical trial 67). Condoms were used by 35% of women (14 of 40) and 65% (26 of 40) reported no contraception use, while contraception use was not documented in 40% (27 of 67). Contraception advice in the 12 months preceding pregnancy was documented in 60% of women (15 of 25) diagnosed with HIV infection before pregnancy. Discussion of contraception Alectinib nmr post-delivery was only documented in less than half (45%) of the notes reviewed. Conception within 6 months after delivery occurred

in 10% (seven of 67) and a further 15% (10 of 67) conceived within 12 months; 47% (eight of 17) of these pregnancies occurred despite documented contraception advice, 88% (15 of 17) were unplanned and 12% (two of 17) were terminated (data not shown). The majority of pregnancies (82%; 41 of 50) were unplanned. Only four patients were taking HAART at conception. Of the 94% (63 of 67) who started ART during pregnancy, prevention of vertical transmission was the sole indication in Inositol monophosphatase 1 81% (51 of 63). ZDV monotherapy was prescribed in 22% of patients. Forty-eight per cent were on a PI-based regimen and 30% on an NNRTI-based combination. ART-associated side effects were

reported by 31% of women (20 of 63), the most frequent being nausea and vomiting (14 of 20). Two patients developed a rash. Treatment was interrupted in 15% of women (three of 20) who reported side effects (data not shown). One hundred per cent adherence was self-reported by 59% of women (34 of 58). An HIV VL <50 copies/mL at or closest to delivery was documented in 62% of women (39 of 63). Pregnancy-related complications such as gestational diabetes (n=1), pre-eclamptic toxaemia (n=2) and antepartum haemorrhage (n=1) were seen in 13% of patients (individual data not shown). Mode of delivery was normal vaginal delivery in 29%, elective Caesarean section in 56% and emergency Caesarean section in 15%. Of the 67 deliveries, 14 (21%) were preterm (<37 weeks) with more than half (eight of 14) occurring at ≤34 weeks. More than half of patients (64%; 36 of 56) received intrapartum intravenous ZDV. There were 66 (99%) live births, of which 82% (50 of 61) received ZDV monotherapy as prophylaxis. The one HIV-infected infant had a positive HIV DNA PCR test within 48 h of delivery, indicating in utero transmission.

2b) On the other hand, although the motA and motB mutants produc

2b). On the other hand, although the motA and motB mutants produced flagella, they were still unable to move because MotA and MotB formed a proton channel that transferred proton-motive force to drive the flagella (Asai et al., 2003); either motA or motB gene mutations resulted in the production of nonfunctional flagella (Figs 2b and 3c). These data demonstrate that the swarming of C. freundii is dependent on functional flagella, as in other swarming bacteria (Kearns, 2010). The largest gene cluster identified in our study is involved in the synthesis of lipopolysaccharide. Altogether, 13 mutants were isolated,

of which six mutated genes –wzx, rfaL, rfbX, rfaJ/CKO_05084, rfaJ/CKO_05086, and rfaG– were identified. The swarming ability of these mutants was dramatically decreased (two of them are shown in Fig. 3g and h as examples). As observed directly Bafilomycin A1 cost under inverted microscope, only a few bacterial cells were actively motile in the swarming colonies of these mutants and these were mainly distributed at the edges. In the central region, most cells formed aggregates that scarcely moved (Videos S2 and S3). In contrast, PKC412 research buy in wild-type colonies, all swarming cells were actively motile (cells in the edge of colonies were less active) and no aggregation was observed (Video S1). The hydrophilicity

of these mutants was decreased compared with the wild type (Fig. S2), which could have led to the aggregation. In a previous study, many transposon swarming mutants isolated in Salmonella enterica serovar Typhimurium have been shown to have mutations in the lipopolysaccharide biosynthetic pathway (Toguchi et al., 2000). The authors suggested that

the O antigen directly or indirectly improved the surface wettability required for swarm colony expansion. Our observation showed that the polysaccharide structure on the cell surface had important role not only in overcoming Edoxaban friction between bacterial cells and media surface, but also in reducing intercellular interaction. The poorly motile aggregates formed with bacteria on the agar surface because of the O antigen defects could account for the defective swarming in addition to the decreased wettability of the agar surface. rcsC and rcsD mutants were identified in this study, and both mutants displayed defective swarming behavior (Fig. 3a and b). The products of rcsC and rcsD, together with RcsB, constitute the regulator of the capsule synthesis (Rcs) phosphorelay system. The regulator RcsB is activated by the transfer of a phosphate group from its cognate sensor, RcsC, through a histidine-containing phosphotransmitter (Hpt) domain intermediate called RcsD (previously called YojN; Takeda et al., 2001). The Rcs system has been implicated in the regulation of bacterial responses to osmotic and other kinds of membrane stress, growth at low temperatures in the presence of glucose and zinc, and growth on solid surfaces (Carballes et al.

This drug is a coformulation of lopinavir and a subtherapeutic do

This drug is a coformulation of lopinavir and a subtherapeutic dose of ritonavir. Administered alone, lopinavir exhibits poor bioavailability; however, the subtherapeutic dose of ritonavir included in this drug [a potent cytochrome P450 (CYP) 3A4 inhibitor] inhibits the metabolism of lopinavir, resulting in higher blood levels of lopinavir [13]. Further, lopinavir

is the active ingredient in this drug that provides the anti-HIV activity. Abbott Laboratories therefore pursued a strategy of coadministering lopinavir with subtherapeutic doses of ritonavir. Therefore, lopinavir is only marketed as a coformulation with ritonavir. BMN 673 clinical trial It is the first combination pill to contain a drug (lopinavir) not available individually [13]. Similar to other protease inhibitors, prolonged use of lopinavir/ritonavir has been reported to be associated with several adverse orofacial effects [14–16]. XL184 The oral epithelium functions as a protective barrier against environmental stress. A compromised epithelial layer allows micro-organisms and toxic materials to access the underlying tissues.

To maintain a functional epithelial lining, epithelial cells undergo a well-defined differentiation programme resulting in the expression of several structural proteins whose function is to maintain the integrity of the Exoribonuclease epithelial tissues [17]. The normal structural integrity and function of the oral epithelium are still susceptible to damage resulting from its masticatory function. Normally, the high rate of growth allows a rapid wound healing response when there is a breach in the epithelial lining. Therefore, differential changes in the rate of epithelial turnover during treatment with HAART may significantly affect the acquisition of oral disease. Cytokeratins are a subfamily of intermediate filament proteins and are the fundamental markers of epithelial differentiation.

These proteins show considerable heterogeneity and specificity among epithelial tissues, and their expression varies with proliferation and differentiation and state of development [18]. Cytokeratin filaments specifically interact with the specialized plasma membrane domains termed ‘desmosomes’. Desmosomes are a major component of cellular adhesion, acting both as cell-to-cell connection points and as attachment sites for the intermediate filaments. Desmosomes are therefore important for the maintenance of tissue integrity [19]. Protease inhibitors, including lopinavir/ritonavir, have been shown to produce several adverse oral complications. However, the effects of these drugs on the oral epithelium have not been studied widely. We have initiated studies to analyse the effect of antiretroviral drugs on the growth of the oral epithelium.

, 1993) rpoA-specific primers were designed based on rpoA nucleo

, 1993). rpoA-specific primers were designed based on rpoA nucleotide sequences of S. pneumoniae (GenBank accession number AM286896), S. oralis (GenBank accession number AM269658), and S. mitis (GenBank accession number AM269625) in the public database using the primer3 program (Rozen & Skaletsky, 2000) with default settings. The primer sequences were rpoA – F (5′-CACAGTTCCAGGTGTTCGTG-3′; positions 47–66) and rpoA – R: (5′-TGCTGAAAGCCCTAAAGCAT-3′;

positions 472–491). The primers used for the PCR amplification and sequencing of the 16S rRNA gene were derived from conserved regions of previously described 16S rRNA gene sequences of eubacteria: 27F (5′-AGAGTTTGATCMTGGCTCAG-3; positions 8–27, Escherichia coli) and 1525R (5′-AAGGAGGTGWTCCARCC-3′; complementary to Selleckchem Saracatinib position 1525–1509, E. coli) (Lane, 1991). PCR was performed with 100 ng of genomic DNA template in 25 μL reaction mixtures containing 1 mM each primer, 2.5 μL reaction buffer, 0.2 mM dNTPs, 1.5 mM MgCl2,

and 2.5 U Taq polymerase (Roche Diagnostics, Indianapolis, IN). Amplification was carried out in a GeneAmp PCR system 2700 (Applied Biosystems, Foster City, CA) with the following click here primary PCR cycling conditions: initial denaturation at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 64 °C for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 10 min. Electrophoresis of each PCR product in 1.2% SeaKem LE agarose gels (FMC Bioproducts, Rockland, ME) was performed, followed by ethidium bromide staining. The results were viewed under a GelDoc XR image-analysis system (BioRad, Hercules, CA). Partial rpoA gene (445 bp) and nearly complete

16S rRNA gene (c. 1500 bp) sequences were directly sequenced fantofarone using a BigDye terminator cycle sequencing kit (Applied Biosystems) and an automatic DNA sequencer (model 3730; Applied Biosystems). The resultant sequences were aligned using the clustalx program (Thompson et al., 1994) and computer-assisted phylogenetic trees were constructed using the neighbor-joining algorithm (Saitou & Nei, 1987), least-squares (Fitch & Margoliash, 1967), and maximum-likelihood (Felsenstein, 1981) methods from the phylip suite of programs (Felsenstein, 1989). Evolutionary distance matrices were generated using the neighbor-joining method described by Jukes & Cantor (1969) and tree topology was evaluated using bootstrap analysis (Felsenstein, 1985) of the neighbor-joining dataset with the seqboot and consense programs from the phylip package. The nucleotide sequences obtained in this study were deposited in the NCBI GenBank under accession numbers GU045377–GU045404 for rpoA and GU045405–GU045432 for the 16S rRNA gene. Both rpoA and 16S rRNA genes were successfully amplified from the genomic DNA of all 28 streptococci strains. The estimated size of the amplified PCR products was 445 bp for the N-terminal region of rpoA and about 1500 bp for the 16S rRNA gene.

21/2007-77) Plasma HIV-1 RNA levels (VL) were measured using an

21/2007-77). Plasma HIV-1 RNA levels (VL) were measured using an Amplicor HIV-1 monitor system (Roche, Rotkreuz, Switzerland) or the Real-Time PCR HIV-1 system (Abbott Laboratories, Des Plaines, IL). find more CD4 cell counts were

measured using the Dynal® T4 Quant Kit (Dynal Biotech ASA, Oslo, Norway). Adherence to HIV therapy was scored as good, intermediate or poor by self-reporting by the patients in face-to-face interviews during ordinary clinical visits and from the medical records. The scoring system has been established by the Ministry of Health in Honduras following the Spanish recommendations [13]. Thus, adherence was scored as good when the patients reported having missed fewer than three doses in the last month; intermediate when three to 12 doses had been missed, and poor when more than

12 doses had been missed. Blood samples (10–20 mL of sodium citrate-treated whole blood) for genotypic resistance testing were collected in Honduras. Plasma and PBMCs were separated in a polyester gel and a density gradient liquid (BD Vacutainer™ CPT™ Tube) and stored at −80 °C in Honduras before GSI-IX in vivo shipment to Sweden for genotypic resistance testing. Resistance testing was carried out on plasma RNA or PBMC DNA using an in-house method. Briefly, RNA or DNA was extracted from plasma or PBMCs using the QIAmp RNA or DNA kit (Qiagen, Hilden, Germany). The RNA was oxyclozanide used to generate cDNA, whereas the DNA was directly used for polymerase chain reaction (PCR). A nested PCR for the pol gene was performed for sequencing

using a reaction mixture and cycling conditions as described previously [14], with some modification of primers. The PCR primers were JA269 (outer forward AGGAAGGACACCARATGAARGA), JA272 (outer reverse GGATAAATCTGA CTTGCCCART), JA270 (inner forward GCTTCCCTCARATCACTCTT) and JA271 (inner reverse CCACTAAYTTCTGTATRTCATTGAC). The sequencing primers were JA273 (outer forward CCCTCAAATCACTCTTTGGC), JA274 (inner forward AAAATC CATACAATACTCCA), JA275 (inner reverse TTATTGAGTTCTCTGAAATC) and JA276 (outer reverse TGTATATCATTGACAGTCCA). DNA sequencing was performed on an ABI Prism™ 3100 Genetic Analyser (Applied Biosystems, Stockholm, Sweden). The sequence fragments were assembled and analysed using the software program sequencher™ (Gene Codes Corporation, Ann Arbor, MI, USA). The HIV-1 pol sequences have been submitted to GenBank under accession numbers FJ800379–FJ800386, FJ800388–FJ800438, FJ800440–FJ800505 and FJ823645–FJ823657. Major and minor resistance mutations according to the 2007 list of the International AIDS Society–USA Panel Guidelines [9] were identified using the Stanford hivdb program (http://hivdb.stanford.edu). The predicted susceptibilities of the viruses to NRTIs, NNRTIs and PIs were estimated using the ANRS algorithm (July 2008, version 17; http://www.medpocket.com).