A uniform film of the CNT/metal binder mixture with the thickness

A uniform film of the CNT/metal binder mixture with the thickness of approximately 20 μm was prepared on the copper tip after an annealing process at 900°C (Figure  6a). The magnified FESEM images of the CNT/metal

binder mixture (Figure  6b) show that vertically standing CNTs of different heights (Figure  6c) as well as CNTs lying on the side (Figure  6d) were formed on the surface. One end of the vertically standing CNTs was generally embedded in the binder film, suggesting strong adhesion to the coating. In contrast, agglomerates of amorphous carbons or CNTs (rectangular regions in Figure  6d) that were not bound to the coating materials were also observed. The agglomerates of amorphous carbons or CNTs were 3-deazaneplanocin A attributed to an incomplete purification process that was described in the ‘Methods’ section. These agglomerates exert negative effects on the stable operation of the field emitter. Figure 6 FESEM images of the fabricated CNT emitter on a copper tip substrate.

(a) FESEM image of a CNT/metal binder coated on a copper tip substrate using the metal mixture binder annealed at 900°C. (b) Cetuximab order Magnified FESEM image of the CNT/metal mixture binder shown in (a). (c, d) Magnified FESEM images of the regions marked in (b). In order to remove the loosely bound carbon agglomerates, the as-prepared CNT emitters were treated with electrical conditioning processes [29]. Electrical conditioning is a process to induce arcing intentionally to remove the materials that negatively affect field emission. An electrical conditioning process was carried out by increasing the applied electric field at the emitters by 0.033 V/μm

(corresponding to 500 V in these experiments) to 0.83 V/μm (Figure  7a). The electric field at each step was maintained for 5 min, and three runs of the conditioning processes were performed for each CNT field emitter. It should be noted that the electric field (abscissa) shown in Figure  ioxilan 7a was calculated by dividing applied voltage by the emitter-anode distance. However, actual electric fields are much higher than the abscissa values. This is because small metal tips (diameter, 1 mm) were used as the substrates of CNT emitters in our experiments and such small metal tips produce higher electric field than a flat substrate at the same applied voltage [30]. While the electric field was increasing, many arcing events occurred because loosely bound materials on the surface were removed by the strong electric field [14–16]. After three runs of electrical conditioning processes, the loosely bound materials shown in Figure  6d were almost completely removed (Figure  7d). Meanwhile, arcing events inevitably occur during the field emission at emission current densities higher than a critical density of approximately 50 mA/cm2[22, 23]. This is because emitting CNTs are self-heated due to Joule heating, which can result in a thermal runaway over the critical current density.

Data were analyzed by using the survival analysis approach (Kapla

Data were analyzed by using the survival analysis approach (Kaplan-Meier Method). Significant treatment Daporinad solubility dmso effects were found among the groups (P < 0.01) by an overall comparison. Pairwise comparisons revealed that compounds 1–6 prolonged survival time in mouse infection models as compared to negative control (p < 0.01), and that compound 4 and 5 were almost as effective as positive control PNC (P > 0.1), but the other compounds were less effective than it (P < 0.05 or P < 0.1). *P < 0.01 indicates significant differences as compared to negative control; #P < 0.05 and $P < 0.1 indicate significant differences as compared to positive

control. Molecular modeling of VicK’ protein and its potential inhibitors In order to get insight into the mechanism of inhibition, further studies were carried out to verify the interaction modes between six compounds and the modeled structure of VicK’ protein. Autodock 3.05 software was used for the docking simulation. The binding conformations of these inhibitors in the ATP-binding pocket of the VicK HATPase_c domain were shown in Figure 8. Although these structures are diverse, the binding models of six potential inhibitors

are similar, especially in the inner part of the conserved domain. The surface of the binding pocket (Figure 2C) is divided into two parts, one is hydrophobic inner part composed of residues ILE146, ILE175, LEU180, ILE182, PHE238, and the other is the outer hydrophilic part consisted of residues ASN149, LYS152, TYR153, ARG196,

ARG199. All six compounds bind in the pocket with rigid aromatic ring click here parts inserting into the inner part. In the large and flexible outer part, these compounds adopt different interactions. All of them have hydrogen bond acceptors in the binding outer part. They could form hydrogen networks with the polar residues to stabilize the substrate interactions. Their binding models resemble natural substrate ATP much. Figure 8 Three-dimensional structural binding modes of six potential inhibitors to VicK’ protein derived from the docking simulations. The loop covered on the pocket was shown in tube. Six compounds were shown in stick with learn more different colors. Their binding conformations showed similar interaction modes in the inner pocket. The binding diversity was restrained by small space and hydrophobic characteristic. By contrast, these structures bound in the outer pocket in various ways. This image was generated using the PyMol program http://​www.​pymol.​org/​. Discussion In bacteria, HKs have fundamental roles in TCS signal transduction pathways. Thus they are major targets for antibacterial drug development. High structural and sequence homology of this kinase gene family makes the HKs ideal targets for homology modeling and structure based virtual screening.

haemolyticus isolates [10] The relationship of ChoP expression b

haemolyticus isolates [10]. The relationship of ChoP expression between NT H. influenzae and H. haemolyticus is unknown but differences

between the species may highlight important roles in NT H. influenzae virulence. In studies addressing NT H. influenzae virulence, ChoP-modified LOS has been shown to promote bacterial adherence and invasion Tanespimycin supplier of host cells through interaction with the platelet activating factor receptor, to increase bacterial resistance to host antimicrobial peptides such as cathelicidin (or LL-37/hCAP18), and to modulate the host inflammatory response directed toward bacteria present in biofilms [20–22]. Paradoxical to its role in enhancing colonization and virulence, ChoP can bind C-reactive protein (CRP) which initiates C1q binding that leads to activation Selleckchem Buparlisib of the classical complement pathway and bactericidal killing [23]. The concentration of CRP (in both serum and respiratory tract secretions) dramatically increases during inflammation, and has been proposed to facilitate clearance of ChoP-expressing

bacteria in the respiratory tract [24, 25]. Human ChoP-specific antibodies capable of eliciting in vitro bactericidal activity against some H. influenzae strains have also been identified, suggesting a further liability of H. influenzae ChoP expression [26]. H. influenzae may avoid CRP and anti-ChoP antibody binding, however, by phase varying ChoP expression and by strain-dependent localization of ChoP substitutions within LOS [27, 28]. In H. influenzae, ChoP expression is controlled by a contingency locus, lic1, that contains

the licA, licB, licC, and licD genes (encoding a choline kinase, a choline permease, a pyrophosphorylase, and a diphosphonucleoside choline transferase, respectively) [29]. Contingency loci, such as lic1, contain simple sequence repeats (SSR) that RNA Synthesis inhibitor provide an organism with the ability to phase vary specific phenotypes in response to host challenges [27]. In lic1, the SSR are tetranucleotide (5′-CAAT-3′) and are present at the 5′ end of licA, the first gene in the locus [29]. During replication, intragenic SSR repeats undergo slipped-strand mispairing which results in translational phase variation, and the rate of these mutations is proportional to the length of the repeat region [30]. De Bolle et al [31] found that mutation rates of a H. influenzae type III restriction modification gene (mod) engineered to contain 17-38 tetranucleotide (AGTC) intragenic repeats increased linearly with the number of repeats. In contrast, the same gene containing 5-11 repeats demonstrated rare, if any, phase-variation. Thus, higher numbers of repeats in a contingency locus may protect the bacteria by decreasing the response time to host challenges [27]. Among H. influenzae strains, however, the number of licA gene 5′-CAAT-3′ repeats range from 3-56, and patterns pertaining to virulence have not been identified [32, 33]. Depending on the H.

After washing, the cells were cultured in dishes covered with a s

After washing, the cells were cultured in dishes covered with a solution containing poly-L-lysine (200 μg/ml, Sigma Chemical, St. Louis, MO, USA), in DMEM containing 10% FCS, 100 U/ml penicillin (Invitrogen), 100 μg/ml streptomycin (Invitrogen), 2 μM forskolin (Calbiochem, La Jolla, CA, USA), and 20 μg/ml bovine pituitary extract (Biomedical Technologies, Stoughton, MA, USA). After the first passage, SCs were further selected

from fibroblasts by using an anti-mouse Thy 1.1 antibody (undiluted hybridoma culture supernatant, American Tissue Culture Collection, Manassas, VA, USA) and rabbit complement (Sigma). This resulted in approximately 97 – 99% pure SC cultures as assessed by S100-β (DAKO, Carpinteria, CA, USA) immunoreactivity. SC-enriched cultures were maintained in a humidified air/CO2 (95%/5%) atmosphere at 37°C. Because a limited amount of primary

SCs was available, pilot experiments learn more were performed with the ST88-14 tumor cell line (Schwannoma cells). The ST88-14 cells, isolated from a patient with neurofibromatosis type 1 [24], were kindly donated by J.A. Flechter (Dana-Farber Cancer Sorafenib in vivo Institute, Boston, MA, USA). For inclusion in the present study, the cells were grown in RPMI 1640 medium supplemented with 5% FCS, 1 mM glutamine, 1000 U/ml penicillin, and 50 μg/ml streptomycin. All chemicals were from Sigma. The cells, plated in culture dishes or on cover slips in 24-well plates (Falcon, Franklin Lakes, NJ, USA), were maintained in a humidified air/CO2 SSR128129E (95%/5%) atmosphere at 37°C for 24 h. Phenotypic identification

of SCs The SCs cultures, both ST88-14 cells and Schwann cell primary cultures, were treated with PBS + 0.3% Triton X-100 (Sigma) and blocked with 10% normal goat serum (NGS). For phenotypic identification of SCs, the cultures were incubated with mouse monoclonal antibody anti-S100-β (Sigma), a Schwann cell marker [25]. After reaction with the primary antibodies of interest, cells were incubated with goat anti-rabbit IgG and/or goat anti-mouse IgG secondary antibodies. Soon after, the cells were washed in PBS pH 7.4 and mounted with N-propylgallate in PBS-glycerol and coverslipped. Expression of MR and uptake of a mannosylated neoglycoprotein by SCs SCs were tested for the expression of MR by labeling with a polyclonal antibody, produced in rabbits, directed against a C-terminal peptide of murine MR (anti-cMR, 1/100), kindly donated by Dr. Anne Régnier-Vigouroux [19]. A cytochemistry assay with 50 μg/ml of the neoglycoprotein mannosyl/bovine serum albumin-FITC-conjugated (man/BSA-FITC, Sigma) diluted in Ringer solution containing 5 mM CaCl2 and 1% BSA at 37°C for 1 h was performed in order to confirm the internalization pattern in SCs. Both expression and functional analyses (MR-mediated endocytosis) of the MR in SCs were performed as previously described by us in detail [20,7]. Interaction assay of S. pneumoniae and SCs Strain S.

Hence, the pilicides block the formation of pili by preventing a

Hence, the pilicides block the formation of pili by preventing a DSE reaction. Pilicides bind to the hydrophobic patch of residues located in the F1, C1, D1 region of the N-terminal domain conserved in all chaperones [23]. This region encompasses part of the F1-G1 loop which is structurally rearranged during the formation find more of the chaperone-subunit complex (DSC reaction). The dynamic nature of this region is also reflected in the pilicide binding modes observed in the crystal structures of the pilicide in the complex with a free PapD chaperone

or the PapD-PapH complex [23, 24]. Although, pilicide interactions with conserved I93, located at the end of the β-strand F1, with L32 and with the V56 patch are preserved in these two structures, the electrostatic interactions between R96, located within the loop F1-G1, and R58 residues and carboxyl and carbonyl groups of pilicide are broken as a consequence of the PapH binding to the PapD [24]. The important differences in the structure of the F1-G1 hairpin and the mechanism of

DSC reaction observed between the FGS and FGL assembly systems might potentially affect pilicide binding. This gives rise to the question as to whether pilicides that were originally designed on the basis of the structure of the FGS-type PapD and FimC chaperones and were evaluated as inhibitors of the biogenesis of the P and type 1 pili are also active in respect of the FGL

assembly pathway. In this study, we addressed a question denoting the activity of pilicides HER2 inhibitor as inhibitors of the assembly of the Dr fimbriae encoded by the dra operon of uropathogenic E. coli – the model of the FGL-type adhesive structures [25, 26]. These organelles are homopolymers of a single DraE subunit, the structure see more of which has three receptor binding sites interacting with the following host-cell molecules: Dra blood-group antigen presented on the CD55/decay-accelerating factor (DAF), the carcinoembryonic antigen (CEA)-related cellular adhesion molecules and the 7S domain of basement membrane protein type IV collagen [27–29]. The assembly of Dr fimbriae is dependent on the action of the DraB chaperone and the DraC usher [17]. The data presented in this article are also important from the epidemiology point of view, as uropathogenic E. coli Dr+ strains are responsible for 20–25% of cases of cystitis and 30% of pyelonephritis in pregnant woman [30]. Methods General synthesis of pilicides The reagents were purchased from Sigma-Aldrich. The analytical TLC was performed on aluminum sheets of silica gel UV-254 (Merck). The flash chromatography was carried out using Zeochem silica gel with particle size of 40–63 microns. The NMR spectra 1H and 13C were recorded at Varian Gemini 200 and Varian Unity Plus 500 in CDCl3 or DMSO. The melting points are uncorrected.

Our results imply that there are no E coli strains that have gen

Our results imply that there are no E. coli strains that have generally high or low levels of persisters; instead, there are different types of persister cells within populations, and each type may be more or less persistent to different antibiotics. Importantly, the variation in persister fractions exists even for antibiotics with nearly identical modes of action (ciprofloxacin and nalidixic acid). Mechanistically, this suggests that persistence through cell dormancy is not a single, general phenomenon. Instead, selleck screening library there

may be distinct physiological states of dormancy, each of which is differently susceptible to a particular antibiotic. The idea that there are different types of persister cells that arise from a variety of mechanisms has also been proposed in a recently published study [34]. We note that one complicating factor in this interpretation is that these different persister populations may have different HM781-36B ic50 propensities to form colonies, and that this might explain some of the differences in the shapes of the kill curves that we observed. However, given the range of persister fractions that we observed (over four orders of magnitude), we do not think that this mechanism can fully explain the patterns that we find. It is also possible that

although the isolates that we studied have similar MIC values, they differ in their pharmacodynamics [35]. However, the persister fraction should largely be independent of

the pharmacodynamic behavior; thus this is unlikely to account for the differences that we observe between isolates [34]. Evidence of two different types of persister cells has been shown previously by Balaban et al. [6], and genotypic changes at different loci were associated with each phenotype. Similarly, genetic differences between different E. coli isolates, such as the presence or absence of TA various modules, may affect the production of persister cells (Figure 6). Gefen et al. [36] suggested that large differences in the measurement of persister fractions might arise because antibiotic not exposure begins at different stages of exponential growth (before or after 1.5 hours of growth). However, by growing the cells for four hours, we hope to have minimized such effects, and propose that the large differences we find in persister fractions are not due to differences in growth stage, but to fundamental differences in the mechanisms of persister production. We note that the set of environment isolates that we have used are not known to be pathogenic, suggesting that many of them have had less exposure to antibiotics and the concomitant selection for resistant or persister phenotypes that arises from such exposure.

Several studies have revealed the role of Hfq and sRNAs in post-t

Several studies have revealed the role of Hfq and sRNAs in post-transcriptional regulation of iron responsive genes [18–20]. Hfq is found in many bacterial

pathogens and is a pleiotropic gene regulator; mutants exhibit phenotypes including defects in virulence, growth rates, stress tolerance and biofilm formation [21]. The phenotypes of hfq mutants vary greatly between bacterial species because of the wide array of RNA with which Hfq interacts [17]. Here we report the characterization of a deletion mutant of hfq in H. influenzae. We demonstrate in vitro that Hfq is important in modulating Selleckchem NVP-AUY922 the utilization of heme from hemoglobin. Further we show that Hfq plays a role in pathogenesis in the infant

rat and chinchilla models of disease. Thus, Hfq may be modulating nutrient utilization systems that allow H. influenzae to better adapt to niches within the host during infection. Methods Bacterial strains and growth conditions Nontypeable H. influenzae strain R2866 is a clinical isolate from the blood of an immunocompetent pediatric patient with clinical signs of meningitis following acute OM [22]. Nontypeable H. influenzae strain 86-028NP was isolated from the nasopharynx of a child being treated for chronic OM who underwent tympanostomy and tube insertion [23, 24]. H. influenzae strains were routinely grown on chocolate agar PF 2341066 with bacitracin at 37°C. H. influenzae was also cultured on brain heart infusion (BHI) agar or in BHI broth supplemented with 10 μg mL-1 heme and 10 μg mL-1 β-NAD (supplemented BHI; sBHI) or BHI supplemented with 10 μg mL-1 β-NAD (heme deplete BHI; hdBHI). The antibiotics spectinomycin (200 μg mL-1) and chloramphenicol (2.0 μg mL-1) were used when appropriate. Heme sources Human hemoglobin and heme (as hemin) were purchased from Sigma. Stock heme solutions were prepared at 1.0 mg mL-1 heme TCL in 4% v/v triethanolamine as previously described [25]. Hemoglobin was dissolved in water immediately before use. Construction of the hfq mutant

A deletion mutant lacking the entire hfq gene was constructed using two pairs of primers to amplify regions upstream and downstream of hfq by PCR using strain R2866 DNA as template. Primer pair Hfq_US1 (GAATTCGATTTGTTAGGAAAGCCTGCC) and Hfq_US2 (GGATCCGCGGTTGAAAATTCTCAGGAAA) was used to amplify an 867-bp fragment upstream of hfq with EcoRI and BamHI restriction sites engineered into the primers, respectively, to allow for directional subcloning. Hfq_DS1 (GGATCCAGAAACGAGTTGTCTCCGTG) and Hfq_DS2 (AAGCTTCGAAGTGCGAGTAAACAAAGGC) were used to amplify an 869-bp fragment downstream of hfq with BamHI and HindIII restriction sites incorporated into the primers, respectively. The PCR products were cloned into the TA cloning vector pCR2.1-TOPO (Invitrogen) and the cloned sequences were confirmed by DNA sequencing.

2 μg RNA was used to synthesize single stranded cDNA according to

2 μg RNA was used to synthesize single stranded cDNA according to the manufacturer’s instructions. Real time PCR was performed to amplify the cDNA with the TaqMan Universal PCR Master Mix (LC Sciences, USA) as follows: amplification for 30 cycles at 94°C for 0.5 min, annealing at 55°C for 0.5 min, and extension at 72°C for selleck compound 0.5 min; and then terminal elongation step at 72°C for 10 min and a final holding stage at 4°C. The amplification plots were viewed and the baseline and threshold values (as indicated in the instrument user guide) were set to analyze the results. The relative miRNA expression was calculated using 2-ΔΔCt where ΔCt is the difference between target miRNA or reference miRNA Ct values

in the treated and control samples. ΔΔCt is the difference between the above two ΔCt from target miRNA and reference miRNA. Western blotting A549 cells (cultured in 6-well plate at 1.5 × 105 cells per well) were treated with 10 μmol/L bostrycin for 12, 24, 48, and 72 hours, and total proteins were extracted. Protein samples were separated by SDS-PAGE and electrophoretically transferred onto a polyvinylidene difluoride membrane (Millipore, USA). The membrane was blocked overnight at 4 degree in TBS-Tween 20 (TBST) buffer containing 5% skimmed milk powder. The membrane was washed with TBST (3 × 8 minutes). Membranes

were then incubated overnight at 4°C in primary antibody (125 μL/cm3; diluted 1:1,000) with gentle shaking. The membranes were washed with TBST (3 × 8 minutes) and incubated for 1 h at room temperature in HRP-conjugated secondary antibody (125 μL/cm3; MK-8669 solubility dmso diluted 1:2,500). The membranes were washed with TBST (3 × 8 minutes) and protein signals were detected by chemiluminescence kit (Cell signaling Technology, USA). Statistical analysis Normally distributed continuous variables were compared by one-way analysis of variance (ANOVA). When a significant difference between groups was apparent, multiple comparisons of means were performed using the Bonferroni procedure with type-I error adjustment.

Data are presented as means ± SD. All statistical assessments were two-sided and evaluated at the 0.05 level of significant difference. Statistical analyses were performed using SPSS 13.0 statistics Montelukast Sodium software (SPSS Inc, Chicago, IL) Results Bostrycin inhibited the proliferation of A549 cells First, we used the MTT assay to detect effect of bostrycin on A549 cell proliferation. There was a dose-dependent and time-dependent inhibition of A549 cell proliferation by bostrycin (Figure 1) with an optimal linear relationship seen between 10-30 μΜ of bostrycin. This indicated that bostrycin could significantly inhibit A549 cell proliferation in vitro. Figure 1 Effect of Bostrycin on the proliferation of A549 cells by MTT assay. A549 cells were treated with 10, 20, or 30 μM of bostrycin for 24 h, 48 h or 72 h.

The identification of the arcAB regulon by two fundamentally diff

The identification of the arcAB regulon by two fundamentally different screening approaches emphasizes Doxorubicin concentration the key role of ArcAB in GI colonisation and furthermore underscores the validity of the screening approaches. Our screening assay also identified a Klebsiella two-gene cluster of unknown function, here designated kpn_01507 and kpn_01508, which conferred enhanced GI colonisation

ability to EPI100. KPN_01507 is a putative membrane protein, whereas the use of SignalP 4.0 predicted the presence of a secretory signal peptide in KPN_01508, a signal targeting its passenger domain for translocation across the bacterial cytoplasmic membrane [30]. These findings, therefore, suggest that KPN_01508 may be translocated and/or secreted from the cell. Interestingly, homologues of both genes are found among several sequenced strains of K. pneumoniae but do not appear to be present in E. coli. Future studies may reveal the function of these genes in GI colonisation. The fact that genes associated with metabolism were selected in the in vivo screening buy GPCR Compound Library assay is not surprising since the ability to obtain nutrients for growth is essential for any GI colonizing organism. However, many highly conserved proteins involved in metabolism are increasingly recognized as having additional roles, some of which are related

to bacterial virulence [31]. The GalET cluster may be viewed as an example of such so-called moon-lighting proteins as the colonisation enhancing effect was not associated with galactose fermentation per se but was due to increased resistance against bile salt possibly mediated by the modification

of LPS core synthesis. A key limitation of the library-based technique is its inability to identify interactions among distant genetic Nutlin-3 cell line loci. This limitation could be circumvented by using co-expressed plasmid- and fosmid-based genomic libraries as recently described [16]. Thus, future studies combining the C3091 fosmid library with a co-expressed plasmid-based C3091 library may lead to the selection of more GI-enhancing genes than those obtained in this study. The fact that our screening method is based on a laboratory E. coli strain, as opposed to a commensal E. coli isolate, raises another important point. Genes mutated in the laboratory strain, e.g. recA, would most likely not have been selected if the screening had been carried out using a commensal strain. However, since commensal E. coli are already excellent GI colonisers, it is possible that genes which are important for K. pneumoniae GI colonisation but also present in E. coli commensal strains will not be selected in the screening. However, if the objective is to specifically identify K. pneumoniae virulence genes, using a commensal E. coli strain as a host in the screening will be a favourable approach. Using E. coli as a host has several advantages when it comes to construction, cloning, and expression of the fosmid library.

Willdenowia 17:59–85 Kohn DD, Walsh DM (1994) Plant species

Willdenowia 17:59–85 Kohn DD, Walsh DM (1994) Plant species XL184 mouse richness—the effect of island size and habitat diversity. J Ecol 82:367–377CrossRef Lamoreux JF, Morrison JC, Ricketts TH et al (2006) Global tests of biodiversity concordance and the importance of endemism. Nature 440:212–214CrossRefPubMed Mazaris A, Tzanopoulos J, Kallimanis A et al (2008) The contribution of common and rare species to plant species richness patterns: the effect of habitat type and size of sampling unit. Biodivers Conserv 17:3567–3577CrossRef Orme CDL, Davies RG, Burgess M et al (2005) Global hotspots of species

richness are not congruent with endemism or threat. Nature 436:1016–1019CrossRefPubMed Panitsa M, Tzanoudakis D (1998) Contribution to the study of the Greek flora: flora and vegetation of the E Aegean islands Agathonisi and Pharmakonisi. Willdenowia 28:95–116 Panitsa M, Tzanoudakis D (2001) A floristic investigation of the islet groups Arki and Lipsi (East Aegean area, Greece). Folia Geobot 36:265–279CrossRef Panitsa M, Dimopoulos

P, Iatrou G et al (1994) Contribution to the study of the Greek flora: flora and vegetation of the Enousses (Oinousses) islands (E Aegean area). Flora 189:367–374 Panitsa M, Snogerup B, Snogerup S et al (2003) Floristic investigation of Lemnos island (NE Aegean Buparlisib in vivo area, Greece). Willdenowia 33:79–105 Panitsa M, Bazos I, Dimopoulos P et al (2004) Contribution to the study of the flora and vegetation of the Kithira island group: offshore islets of Kithira (S Aegean, Greece). Willdenowia 34:101–115 Panitsa M, Tzanoudakis D, Triantis K et al (2006) Patterns of species richness on very small islands: the plants of the Branched chain aminotransferase Aegean archipelago. J Biogeogr

33:1223–1234CrossRef Panitsa M, Tzanoudakis D, Sfenthourakis S (2008) Turnover of plants on small islets of the eastern Aegean Sea within two decades. J Biogeogr 35:1049–1061CrossRef Raus T (1989) Die Flora von Armathia und der Kleininseln um Kasos (Dodekanes, Griechenland). Bot Chron 9:19–39 Raus T (1996a) Additions and amendments to the flora of the Karpathos island group (Dodekanesos, Greece). Bot Chron 12:21–53 Raus T (1996b) Flora von Paros und Antiparos (Kykladen, Griechenland). Ann Naturhist Mus Wien 98(B Suppl):237–278 Rechinger KH (1950): Grundzüge der Pflanzenverbreitung in der Ägäis I-III. Vegetatio 2:55–119, 239–308, 365–386 Rechinger KH, Rechinger-Moser F (1951) Phytogeographia Aegaea. Akad. Wiss. Wien, Math. Naturwiss Kl. Denkschr 105:1–208 Ricklefs RE, Lovette IJ (1999) The roles of island area per se and habitat diversity in the species–area relationships of four Lesser Antillean faunal groups. J Anim Ecol 68:1142–1160CrossRef Runemark H (1969) Reproductive drift, a neglected principle in reproductive biology. Bot Nat 122:90–129 Runemark H (1970) The role of small populations for the differentiation in plants.