5C) of IL-32-treated mice than in placebo controls on day 10 after 5-FU injection. This

paralleled a higher marrow cellularity in bone sections (Fig. 5C) with twice the number of cells in 5 μg IL-32-treated mice (Table 3, p=0.046) and three times the numbers of colony-forming cells (p=3.3×10−5). The higher number of BM cells paralleled a higher frequency of SCA-1+c-kit+ cells, which was comparable with non-treated controls (Table 3). Mice that had received 50 μg IL-32 had twice the BM cell count of untreated specimens on day 14 (64.4±10.9×105 cells versus normal saline 32±8.2×105 cells, p=0.024), whereas the values of those treated with 5 μg were between those of the normal saline and the 50 μg IL-32 groups (46.9±8.3×105). Two weeks after 5-FU and IL-32 treatment,

the number of total PF-01367338 ic50 colonies rose to 3.8±1.2×103 in the normal saline-treated control; that was still surpassed by the results in 5 μg IL-32-treated mice (9.5±1.6×103, p=0.006) and in 50 μg IL-32-treated mice (6.4±0.87×103). As we demonstrated, endothelial gene signals of several cytokines were significantly upregulated upon stimulation with IL-1β for 4 h. These included IL-8, IL-32, FGF-18, OPG, CXCL1 to 6, CCL2 to 6 and CCL20. Selleck Proteasome inhibitor Using a complex experimental design, we evaluated the HPC expansion potentials of 11 gene products: FGF-18, IL-8, Gro proteins 1, 2 and 3 (also called CXCL1 to 3), OPG, IL-32, ENA-78 (also called CXCL5), GCP-2 (also called CXCL6) and the chemoattractants CCL2 and CCL20. Although none Nutlin-3 clinical trial of these are known to affect HPC expansion, some of them can induce the proliferation of other cell types. FGF-18, for example, stimulates the proliferation of hypernephroma cells and induces hepatocellular proliferation in vivo 25. As an inflammatory cytokine, IL-8, also called GCP-1, induces the proliferation of cancer cells 26 and ECs in an autocrine fashion 27. Other

granulocytic chemoattractants like ENA-78 and GCP-2 induce hepatocellular 28 and carcinoma cell 29 proliferation. IL-32, another proinflammatory cytokine, is produced by natural killer cells upon stimulation with IL-2. IL-32 can induce the differentiation of monocytes into macrophages, but reverses GM-CSF-induced macrophage differentiation 30. To our knowledge, this is the first time that the hematopoietic growth factor properties of OPG, Gro 3, and especially IL-32 are demonstrated. In previous studies, several CXC chemokines, such as IL-8, ENA-78 and MIP-2, have been tested in vitro for their BM suppressiveness. That was determined according to a reduced colony-forming capacity of cytokine-treated myeloid progenitors, in which each chemokine was added to a standard cytokine combination in colony assays 31, 32. We chose instead to apply the candidate factors directly to isolated HPCs and assess the cultured cells’ hematopoietic qualities by flow cytometry, colony and cobblestone assays.

The patients were grouped into the following categories: International Federation of Gynecology and Obstetrics (FIGO) stage IB (n = 16) and stage IIA–IIIB (n = 24). All tissues were subjected to immunohistochemical staining for IL-32 as described previously27

and clinically correlated with FIGO stage and survival, and the following results were obtained. In the serial section, immunohistochemical staining for COX-2 was also conducted to determine whether IL-32 and COX-2 are co-localized in cervical cancer cells. This study was approved by the Chungnam National University Hospital. The IL-32γ and COX-2 were amplified from the genomic DNA of human CaSki cells via PCR, using the following primers, respectively: IL-32γ: 5′-CTGGAATTCATGTGCTTCCCGAAG-3′ (forward), 5′-GAAGGTCCTCTCTGATGACA-3′ (reverse); COX-2: 5′-CCCAAGCTTGGGCTCAGACAGCAAAGC CTA-3′ (forward), 5′-CTAGTCTAGACTAGCTACAGTTCAGTCGAACGTTCTTT-3′ (reverse). Interleukin-32γ check details DNA Synthesis inhibitor was cloned into the EcoRI and XhoI sites of pCDNA3.1 using EcoRI and SalI, and COX-2 was ligated with pCDNA3.1 vector using the HindIII and XbaI sites. The promoters of IL-32 and COX-2 were amplified via PCR from human genomic DNA. The IL-32 promoter (−746/+25) was constructed as previously reported.21 The COX-2 promoter (−880/+9) used the following primers: 5′-CGGGATCCAAATTCTGGCCATCGCCGCTT-3′ (forward), 5′-CCAAGCTTTGACAATTGGTCGCTAA

CCGAG-3′

(reverse) cloned into the MluI and HindIII sites of the pGL3-basic vector, and the inserted sequences were confirmed via DNA sequencing. Both pTarget/E7 and pTarget/E7 antisense (E7AS) were described in a previous report.25,28 C33A/pOPI3, C33A/E7, SiHa and CaSki cells were seeded on six-well plates at a density of 3 × 105 cells per well, then grown to confluence, reaching approximately 80% at the time of transfection. For each well, plasmid DNA (1 μg) was introduced into the cells using an identical volume of Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s instructions. The pTarget Phenylethanolamine N-methyltransferase and pTarget/E7AS plasmid were transfected into C33A/E7, SiHa and CaSki cells to confirm the E7 oncogene-specific effect on IL-32 and COX-2 expression in HPV-expressing cervical cancer cells. The pGL3 basic, pGL3b/IL-32 promoter, and pGL3b/COX-2 promoter were respectively co-transfected with pTarget, pTarget/E7 and pTarget/E7AS into C33A/pOPI3, C33A/E7, SiHa and CaSki cells to determine the specific effects of E7 on the transcriptional activities of IL-32 and COX-2. Additionally, pCDNA3.1, pCDNA3.1/COX-2, pCDNA3.1/IL-32γ, siCONTROL and siIL-32 (Dharmacon, Lafayette, CO) were respectively transfected into SiHa and CaSki cells to evaluate expression between COX-2 and IL-32 by the HPV E7 oncogene. Interleukin-32γ is the most active form of IL-32 isoforms.

The peptide was constructed by the OUHSC Molecular Biology Proteomics Facility at 1 µg/well coated on a 96-well polystyrene plate overnight at 4°C, washed with PBS, and then blocked with 0·1% bovine serum albumin (BSA) for 1 h at room temperature. Serum samples were diluted at 1:100 and 1:1000 in 0·1% BSA-Tween solution, added to the coated plates and incubated for 3 h at room temperature. Following another wash, alkaline phosphatise-conjugated

anti-human IgG (Jackson Immunoresearch Laboratories) was diluted 1:10 000 and added for Compound Library 3 h incubation at room temperature. The plate was washed again following conjugation and then incubated with para-nitrophenyl phosphate tablets (Sigma Chemical Co., St Louis, MO, USA) dissolved in glycine buffer. Plates were read at a wavelength of 410 nm (Dynex Technologies Inc) and standardized to a common positive control at an OD of 1·0. Identification of antigenic determinants from continuous epitopes such as MPO utilizes empirical methods

by measuring several parameters such as hydrophilicity, flexibility, accessibility, turns, exposed surface, polarity and antigenic propensity of polypeptide chains. Amino https://www.selleckchem.com/products/r428.html Cepharanthine acids that build up a protein carry a charge once in a solution and together give an isoelectric point (pI) which enables protein separation. The average pI of the identified epitopes were computed and compared to the non-antigenic decapeptides and the Protein Data Bank was used to identify the coordinates for the crystal structure of MPO (PDB code 1CXP),

as defined by Fiedler et al. [12]. These coordinates were used to calculate secondary structure solvent exclusion surface areas by using the BALL View version 1.1.1 program [13] and surface areas were calculated using a solvent probe radius of 1·5 Å. We then identified the location and surface availability of our defined epitopes. The Immune Epitope Database and Analysis resource (http://www.immuneepitope.org) was accessed to determine B cell epitope predictions for the published sequence of MPO. All prediction calculations are based on propensity scales for each of the 20 amino acids found among humans and, in general, 5–7 amino acid residues is appropriate for finding regions that may potentially be antigenic.

Although falling within the same rhythmic class, Basque and Spanish exhibit significant differences in their distributions of vocalic intervals (within-rhythmic class variation). All infant groups in our study successfully discriminated between the languages, although each group exhibited a different pattern. Monolingual Spanish

infants succeeded only when they heard Basque during habituation, suggesting that they were influenced by native language recognition. The bilingual and the Basque monolingual infants showed no such asymmetries and succeeded irrespective of the language of habituation. Additionally, bilingual infants exhibited longer looking times in the test phase Selleckchem C59 wnt as compared with monolinguals, reflecting that bilingual infants attend to their native languages differently than monolinguals. Overall, results suggest that bilingual infants are sensitive to within-rhythm acoustic regularities of their native language(s) facilitating language

discrimination and hence supporting early bilingual acquisition. “
“Recent work has suggested the value of electroencephalographic (EEG) measures in the study of infants’ processing of human action. Studies in this area have investigated desynchronization of the sensorimotor mu rhythm during action execution and action observation in infancy. Untested but critical to theory is whether the mu rhythm shows a differential response to actions which share similar goals but have different motor requirements or sensory outcomes. By varying the invisible property of object weight, selleckchem ASK1 we controlled for the abstract goal (reach, grasp, and lift the object), while allowing other aspects of the action to vary. The mu response during 14-month-old infants’ own executed actions showed a differential hemispheric response between acting on heavier and lighter objects. EEG responses also showed sensitivity to “expected object weight” when infants simply observed an experimenter reach for objects

that the infants’ prior experience indicated were heavier vs. lighter. Crucially, this neural reactivity was predictive—during the observation of the other reaching toward the object, before lifting occurred. This suggests that infants’ own self-experience with a particular object’s weight influences their processing of others’ actions on the object, with implications for developmental social-cognitive neuroscience. “
“Hierarchical structures are crucial to many aspects of cognitive processing and especially for language. However, there still is little experimental support for the ability of infants to learn such structures. Here, we show that, with structures simple enough to be processed by various animals, seven-month-old infants seem to learn hierarchical relations.

MRFs simultaneously inhibit the expression of genes instructing alternative lineages such as other MRFs or cytokines instructing opposing lineages (Fig. 1). Furthermore, considering the heritable maintenance of Torin 1 solubility dmso most T-cell subsets, MRFs can potentially propagate chromatin and gene states, perhaps even in the absence of the original signals and ERF activation. In these ways, even with a seemingly small initial regulatory footprint, once induced, MRFs can dominantly influence cellular phenotype. Recent genomic studies provide important

examples of complex transcriptional control of cellular differentiation, and underscore the co-operative and networked action of several

transcription factors in immune cell differentiation.[12-14, 30, 31, 39, 40] Whereas we can appreciate the simple significance of cellular instruction through over-expression of factors like MYOD, FOXP3, and in iPS cells, OCT4, SOX2, KLF4 and c-MYC, studies such as those discussed here reveal that such activity occurs through extensive collaboration with supporting factors. Indeed, experiments establishing the sufficiency of many MRFs for lineage instruction relied on stimulation-dependent over-expression and the coincident activation of crucial see more ERF co-factors. The integration of information in the form of co-ordinated binding of environmental

response factors and nuclear master regulator transcription Lumacaftor clinical trial factors to regulatory sites across the genome (Fig. 1) represents an elegant strategy for initial instruction and subsequent stabilization of immune cell phenotype in response to environmental cues. ERFs play a dominant and immediate role in altering chromatin state and initiating transcription, followed by induced MRF expression resulting in positive feedback transcription loops that stabilize the cellular phenotype. These consecutive steps during CD4 T-cell subset differentiation can be projected onto Waddington’s epigenetic landscape, to indicate the contribution of key transcription factors to the restriction and instruction of developmental potential (Fig. 2). Given the function of MRFs to stabilize cellular phenotype it will be interesting to assess the mechanisms conferring this activity. If not prominent in chromatin remodelling during initial differentiation, are MRFs involved in the maintenance of chromatin accessibility and gene state, in the absence of ERFs, either in quiescent or proliferating cells? Additionally, while early studies of MRFs and STATs focused on signature Th genes with established function, like ifng and the Th2 cytokines, we have little understanding of most of the hundreds to thousands of enhancers that are activated predominantly by ERFs.

The curative potential of allogeneic haematopoietic stem cell transplantation (allo-HSCT) relies strongly upon the immune responses against host antigens mediated by donor T lymphocytes as effectors of anti-tumour immune surveillance [1]. The graft-versus-leukaemia (GVL) effect is exploited further by the use of delayed infusions of donor lymphocytes (DLIs) [2]. However, the therapeutic impact of donor lymphocytes is limited by the risk of allogeneic acute graft-versus-host C59 wnt ic50 disease

(aGVHD). Approximately 55–60% of patients treated with bulk doses of DLIs for recurrent leukaemia develop aGVHD [3]. Recent research has demonstrated that naive but not memory donor T cells are capable of inducing aGVHD [4,5]. aGVHD requires the stimulation of naive donor T cells by antigen-presenting cells (APC). Residual host APCs alone are sufficient for the induction of CD8+ T cell-dependent aGVHD [6]. Following cognate interaction with activated APC, CD4+ T cells are driven towards T helper type 1 (Th1)-biased cytokine production [7], promoting T cell proliferation and further differentiation, so

that very large amounts of proinflammatory cytokines are generated which induce tissue CT99021 order damage in a major histocompatibility complex (MHC)-independent fashion [8]. It has been shown that the infusion of purified CD4+ T cells as DLI resulted in the expansion of CD8+ T cells, suggesting the critical importance of CD4+ T cells in regulating the expansion of CD8+ T cells which mediate aGVHD [9], and the differentiation of CD4+

T cells into Th1 is dictated by the nature of the donor T cell–host APC interaction [10–12]. Phosphatidylinositol diacylglycerol-lyase Therefore, Th1 cells not only mediate aGVHD, but also play a critical role in amplifying aGVHD. We hypothesized that inhibiting artificially the Th1-type differentiation of donor naive CD4+ T cells could prevent aGVHD. Suppressor of cytokine signalling (SOCS) proteins comprise a family of intracellular regulators of cytokine-induced signal transduction. SOCS protein expression is inducible by cytokines, and once expressed, SOCS proteins inhibit cytokine signalling by switching off the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway [13,14]. SOCS expression has been observed at many stages of T cell development and function, and it has been suggested that SOCS-1 and SOCS-3 are important regulators of T cell activation, differentiation and homeostasis [15–19]. It has been shown that naive CD4+ T cells constitutively express low levels of SOCS-1 and SOCS-3 mRNA [15]. Differentiation into Th1 or Th2 phenotypes is accompanied by preferential expression of distinct SOCS mRNA transcripts and proteins. SOCS-1 expression is fivefold higher in Th1 cells than in Th2 cells, whereas Th2 cells contain 23-fold higher levels of SOCS-3.

brucei transcriptome as well as the identification of heterogeneous mRNA trans-splicing and polyadenylation sites (42–44). Furthermore, RNA-seq has allowed the determination of transcript boundaries

and the detection of potential RNA polymerase II transcription initiation sites at single-nucleotide resolution (43). Transcriptome profiling using a digital gene expression (DGE) approach has also resulted in high-sensitivity detection of differentially expressed genes in different life cycle stages (45,46) and confirmed the existence of differentially expressed gene clusters within the same polycistronic primary transcript units (45). The ChIP-seq (chromatin immunoprecipitation coupled with NGS) approach made possible the mapping of RG7422 solubility dmso polycistronic transcription units boundaries with greater reproducibility than ChIP-chip (47) and shed light on chromatin-mediated epigenetic controls in trypanosomes (48).

As RNA Small molecule library purchase interference (RNAi) was first described in T. brucei (49,50), it has become a very powerful tool for reverse genetic analyses in African trypanosomes. The first high-throughput systematic RNAi and phenotypic analysis was performed on chromosome 1 genes in T. brucei and documented phenotypes for 30% of the total targeted genes (51). More recent genome-wide RNAi screens in T. brucei revealed a powerful approach for the discovery of drug transporters and activators (52,53). The application of NGS technologies to high-throughput phenotyping with a genome scale RNAi library (RIT-seq) linked thousands of hypothetical genes to essential functions (54). Much of the information generated from T. brucei RNAi analyses can be found in the TrypanoFAN database (http://trypanofan.path.cam.ac.uk/trypanofan/main/) and a tool for the identification of primers for production of RNAi constructs is also publicly available online (http://trypanofan.path.cam.ac.uk/software/RNAit.html). While the genome sequencing of L. braziliensis demonstrated the retention

of an RNAi pathway and confirmed the presence of an RNAi activity in that organism (23), the loss of this pathway in L. major, L. infantum and T. cruzi, among other trypanosomatids, Arachidonate 15-lipoxygenase clearly results in an inability to exploit this machinery for gene knockdowns. An attempt to reintroduce known RNAi machinery components in T. cruzi genome was not successful (55). However, efforts to knock down the genes in the human host cells have been made at the subgenomic and full genome scale in T. cruzi and are revealing host genes linked to trypanosome intracellular proliferation and survival [B. Burleigh, personal communication and (56)]. Protein translation and turnover are important parts of gene expression regulation. This is particularly the case in trypanosomatids where much of the regulation is believed to occur post-transcriptionally.

falciparum-infected erythrocytes (Pf-IRBC) in blood vessels of the CNS. MIP-3α/CCL20 will stimulate

the migration, homing and maturation of leucocytes, and CCL20 together with CXCL1, CXCL2, IL-6 and IL-8 increased more than 100-fold in blood–brain barrier endothelial cells during Pf-IRBC contact, which suggests its participation in cellular defence during Pf-IRBC sequestration [60]. Astrocytes which line parenchymal blood vessels will respond in a pathogen-specific way to infection and release MIP-3α/CCL20 and CXCL16 [61]; both chemokines will promote Th1-type responses by enhancing IFN-γ and TNF-α release, and CXCL16 may attract neutrophil granulocytes across the blood–brain barrier into the cerebrospinal

fluid [62,63]. Both CCL20 and CXCL16 were elevated substantially in HTS assay SM and MM infants; CCL20 correlated positively with parasite densities, and therefore CCL20 and CXCL16 should be investigated further as to what extent they contribute to the manifestation of CM. The chemokines 6Ckine/CCL21 and CCL19 are both involved in T lymphocyte migration into NVP-BGJ398 CNS tissues during immune surveillance and inflammation [64–66], and expression of their common receptor CCR4 is required for protective immune responses during acute T. gondii infection [67,68]. The abrogation of CCL21 function in mice with L. major infection resulted in failure to clear parasites from infected skin [68]. In the present work, 6Ckine/CCL21 plasma levels were similar in NEG, MM and SM infants,

suggesting that with malaria progression or regression 6Ckine/CCL21, which may promote immune surveillance against intracellular parasite in CNS tissues, has not been activated or remained suppressed. In summary, proinflammatory and regulatory cytokine and chemokines were generated in infants during progression and regression of acute malaria tropica. Proinflammatory type cytokines IL-31 and IL-33 were strongly enhanced, while regulatory IL-27 was lowered with severe malaria. Similarly, the chemokines CCL20 and CXCL16 which promote leucocyte migration into brain parenchyma increased while CCL21, which Vildagliptin mediates immune surveillance in CNS tissues, remained unchanged. These cytokine and chemokine production profiles and their dynamics could be considered for evaluating the progression or regression of malarial disease. We kindly thank all parents who participated in the present work. For their competent assistance we thank the medical assistants and nurses at the Paediatric Ward at the Centre Hospitalier Regional (CHR) in Sokodé in Togo. The authors declare that no conflict of interest exists.

It stimulates mitogenicity and chemotaxis of several cell types, and stimulates production of several matrix molecules. Some of the cellular responses manifest within minutes after PDGF receptor activation. PDGF stimulates rearrangement of actin filaments that comprise the major cytoskeletal components in eukaryotic cells. Alteration of actin polymerization has been implicated in various cell responses, including proliferation Temozolomide molecular weight and motility. Depolymerization of actin filaments impairs the morphology, motility and division of most cells. Coordinated movement is a fundamental cellular process essential for keratinocytes and fibroblasts during wound healing and for the

extravasation of immune cells during inflammation [22]. In a previous study [6], we speculated that anti-PDGF activity may partly explain reports of SGE from I. scapularis affecting cellular adherence and angiogenesis [27, 28]. We also observed a correlation between anti-PDGF activity and the inhibition in proliferation of glioma, PS

and NIH-3T3 cells in vitro (Table 2). The major cellular component of the epidermis is the keratinocytes [29]; the dermal layer contains mainly fibroblasts. Here, we demonstrate the effect of SGE of adult H. excavatum ticks on human skin keratinocytes HaCaT and mouse fibroblasts NIH-3T3, as representatives of two basal skin cell types. The proliferation of HaCaT cells was inhibited to a greater selleck screening library degree than NIH-3T3 fibroblasts by H. excavatum SGE. The highest inhibition of proliferation of both cell lines was obtained by SGE prepared from 7-day-fed females, whereas treatment of cells with SGE of 3-day-fed females had comparatively little effect. Moreover, the shape of both HaCaT and NIH-3T3 cell lines was altered by treatment with SGE from females

feeding for 7 days but not for 3 days. Thymidine kinase This alteration was associated also with loss of cell adhesion to the microtitre plate. Comparison of the treatment of cells with H. excavatum SGE prepared from early phase tick feeding showed that even though the samples contained molecules binding PDGF they did not have a visible effect on actin microfilaments, especially when compared with the pronounced effect of SGE from females in the late phase of engorgement. Such a robust effect on the actin cytoskeleton was not seen even when we used fourfold SGE equivalents of 3-day-fed ticks that we estimate should have equivalent potency in anti-PDGF activity to 7-day-fed females. Thus, it seems that female ixodid ticks with long mouthparts produce, in their salivary glands, additional factor(s) to ensure their invisibility and protect them against attack by the host immune system during the massive blood uptake in the terminal phase of feeding. For example, metalloproteases may play a role in manipulating the wound-healing response as they appear to be abundantly expressed in the salivary glands of Amblyomma and Ixodes species, and they affect cell proliferation and angiogenesis [28, 30].

Second-round PCR cycle conditions consisted of a denaturation step (7 min at 94°C) and 30 amplification cycles (94°C for 1 min, 59°C for 1 min and 72°C for 1 min) in Taq PCR Mastermix using an Eppendorf Mastercycler ep 543X instrument (Eppendorf, Mississauga,

Canada). The primers used were as follows: L-M667 – ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTG; Alu 1 – TCCCAGCTACTGGGGAGGCTGAGG; Alu 2 –  GCCTCCCAAAGTGCTGGGATTACAG; Lambda T – ATGCCACGTAAGCGAAACT; and AA55M – GCTAGAGATTTTCCACACTGACTAA. A total of 250 000 MDDCs differentiated and infected as described above were incubated in 5 ml polypropylene round-bottomed tubes with 1 mg of FITC-conjugated dextran selleck products (Sigma-Aldrich, Milwaukee, see more WI, USA) in the dark for 1 h on ice or at 37°C

and 5% CO2. Cells were then washed in phosphate-buffered saline (PBS) and subjected to flow cytometric analysis using FCS Express 2·00 software. Changes in the phosphorylation of the ERK, JNK and p38 proteins in response to LPS after HIV-1 infection were measured using immunoblot analysis, as described previously [60]. HIV-1-infected or -uninfected MDDCs were centrifuged, incubated in the presence or absence of 2 µg/µl LPS (Escherichia coli, 0111:B4; Sigma-Aldrich) for 1 h at 37°C and 5% CO2. Cells were then collected by centrifugation, washed, and then lysed on ice using 250 µl lysis buffer [0·05 M HEPES, 0·15 M NaCl, 10% glycerol, 1% Triton-X-100, 7·5 × 10−4 M MgCl2, 0·1 M NaF and 0·001 M ethylene glycol tetraacetic acid (EGTA) Clomifene (pH 7·7)] (Fisher Scientific Canada Limited, Ottawa, ON, Canada). Samples were boiled with ×4 treatment buffer [8% sodium dodecyl sulphate (SDS), 10% 2-mercaptoethanol, 30% glycerol, 0·008% bromophenol blue, 0·25 M Tris HCl] for 10 min, and 40 µg of total protein of each lysate was added to each well of an 8% SDS polyacrylamide gel and subjected to electrophoresis. Next, proteins were transferred electrophoretically to nitrocellulose sheets (Protran®, Bioscience, Schleicher

and Schuell, Mandel, ON, Canada) via semidry electrophoretic transfer (Biorad Labratories Inc., Burlington, ON, Canada) and blocked with Amersham™ ECL Advance Blocking agent (GE-Healthcare Bio-Sciences). The membranes were incubated at 4°C with the primary phosphorylated anti-p38, JNK/stress-activated protein kinase (SAPK) or ERK1/2 and β-actin antibodies (9215S, 9251S, 99101S and 4967; Cell Signaling Technologies, New England Biolabs Limited, Toronto, ON, Canada) at a titre of 1:500 in Amersham™ ECL Advance Blocking agent in ×1 Tris-buffered saline (TBS) (Fisher Scientific Canada Limited) plus Tween 20 (Fisher Scientific Canada Limited) (TBST) for 24 h. The membranes were washed and incubated with secondary antibodies bound covalently to horseradish peroxidase (HRP) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at a titre of 1:1000 in Amersham™ ECL advance blocking agent in TBST at 4°C for 24 h.