3 meso M1 5775 151 610 4,11 0,09 1304 2044   8 meso M2 4531 151 483 4,43 0,04 1171 1631   3 thermo M3 2056

142 444 4,68 0,05 1065 2070   8 thermo M4 5083 146 438 3,87 0,07 1127 1827 Arch. 3 meso M1 7926 104 135 2,33 0,17 318 510   8 meso M2 5593 109 109 1,85 0,33 227 339   3 thermo M3 5521 106 95 1,02 0,56 227 375   8 thermo M4 10573 107 167 1,66 0,34 387 565 Fungi 3 meso M1 2850 click here 147 456 4,43 0,06 1068 1609   8 meso M2 8714 233 1602 5,57 0,03 3192 4485   3 thermo M3 8460 209 1386 5,12 0,05 2617 4304   8 thermo M4 16893 220 2162 5,22 0,06 3393 4516 *) kg VS m-3. **) after removing adapters and primers. 454 sequencing The PCR amplification of the sample DNA was conducted with MJ Research PTC-225 thermal cycler (Global Medical Instrumentation) in two check details stages. First, we amplified the DNA with universal bacterial, archaeal and fungal primers in following conditions: initial denaturation at 94 °C for 5 min, 20 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 2 min, and a final extension for 5 min with bacterial and archaeal primers (Table 4). With fungal primers the

applied annealing temperature was 55 °C. In the first round we used eight replicate reactions per sample and pooled and purified the reactions before the second round. In the second round, the amplification was completed with 10 additional cycles with sample-specific barcode sequences

and A- and B-adapters attached to the primers. Each sample was amplified in three replicates. The SIS3 molecular weight amount of template varied between 200 ng and 700 ng per reaction (volume 50 μl) depending on sample and primers. The PCR amplifications were carried out in the first round with Phusion (Finnzymes, Espoo, Finland) (Bacteria) and Biotools (Biotools, Madrid, Spain) (Archaea and Fungi), and in the second round with Truestart (Fermentas, Lithauen) DNA polymerases. After the amplifications, the replicates were pooled and the PCR-products were processed as described previously Lenvatinib mouse [15]. The sequencing was carried out at the Institute of Biotechnology (Helsinki, Finland) using the 454 GS FLX protocol, yielding read length of about 250 bp (454 Life Sciences, Roche Diagnostics, CT, USA). Table 4 PCR primers used for amplicon sequencing in this study Primer Direction Sequence Reference Ar344f forward ACGGGGCGCAGCAGGCGCGA [16] 518 reverse ATTACCGCGGCGGCTG modified from [17] CREN512 reverse CGGCGGCTGACACCAG [18] 341f forward CCTACGGGAGGCAGCAG [19] D’ reverse GTATTACCGCGGCTGCTG [20] 5.8af forward GTGAATCATCGAGTTCTTGAAC modified from [21] 5.8bf forward GTGAATCATCAAATCTTTGAAC modified from [21] 5.8cf forward GTGAATCATCGAGTCTTTGAAC modified from [21] 5.8df forward GTGAATCATCAGTTTTTGAAC modified from [21] 5.

………………….. 2   1. Basal conidia up to 55 μm in length ………………………………………………. 4   2. Intercalary and terminal conidia up to 20 μm long, (7–)12–17(–20) × (1.5–)2(–2.5) selleck chemical μm ……………………………………………………………

S. henaniensis   2. Intercalary and terminal conidia longer than 20 μm ……………………………… 3   3. Basal conidia narrowly cylindrical, up to 2 μm wide, intercalary and terminal conidia (10–)12–25(–30) × (1.5–)2.5(–3) μm ………………. S. pomigena   3. Basal conidia narrowly cylindrical to obclavate, 2.5–3.5(–5) μm wide; intercalary and terminal conidia (22–)25–35(–43) × (2–)2.5(–3) μm ….. S. abundans   4. After 2 weeks on PDA, surface cream to white …………….. S. shaanxiensis   4. After 2 weeks on PDA, surface

leaden-black to leaden-grey in middle, surrounded by orange and leaden-black zones ………………………………. S. asiminae   *Sporulating TPCA-1 supplier on SNA in culture. Acknowledgements This work was supported by National Natural Science Foundation of China (30771735), the 111 Project from Education Ministry of China (B07049), and Top Talent Project of Northwest A&F University. The authors thank the technical staff, A. van Iperen (cultures), M. Vermaas (photo plates), and M. Starink-Willemse (DNA isolation, amplification and sequencing) for their invaluable assistance. Thank you to Derrick Mayfield and Jennifer Blaser for technical assistance. Thanks are also extended to members of the Ministry of Agriculture and Rural Affairs, Rize Branch, Turkey for their help during this study. Open Access This article is distributed under the terms of the Creative Commons Interleukin-3 receptor Attribution Noncommercial License which permits any noncommercial use,

distribution, and reproduction in any medium, provided the original author(s) and source are credited. References Batzer JC, Gleason ML, Harrington TC, Tiffany LH (2005) Expansion of the sooty blotch and flyspeck complex on apples based on analysis of ribosomal DNA gene sequences and morphology. Mycologia 97(6):1268–1286CrossRefPubMed Batzer JC, Arias MM, Harrington TC, Gleason ML, Groenewald JZ, Crous PW (2008) Species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple. Mycologia 100(2):246–258CrossRefPubMed Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, Summerell BA, Shin H-D, Dugan FM, Schroers H-J, Braun U, Crous PW (2010) Species and ecological diversity within the C188-9 nmr Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). Stud Mycol 67:1–94CrossRefPubMed Blaser JM, Karakaya A, Mayfield DA, Batzer JC, Gleason ML (2010) Diversity of sooty blotch and flyspeck fungi from apples in northeastern Turkey. Phytopathology (Abstr) 100(6):S15 Braun U (1995) A monograph of Cercosporella, Ramularia and allied genera (Phytopathogenic Hyphomycetes), vol 1.

A finding of this predicted positive relationship, in spite of the statistical tendency towards a negative relationship, would therefore strongly indicate a real propensity for greater vulnerability among this website species that occur at low densities. We

also included the variable ant density to control for potential effects caused by differences in ant density encountered by different species. Because our dataset included species scattered throughout the phylum Arthropoda, for which phylogenetic knowledge is very incomplete, it was not possible to generate phylogenetically independent contrasts (e.g., Owens and Bennett 2000; Sullivan et al. 2000; Fisher et al. 2003). Instead, we included taxonomic order as a variable in the regression

model to control for major phylogenetic trends (Kotze and O’Hara 2003; Koh et al. 2004). For species that occurred at multiple sites, we averaged the multiple impact scores Compound C chemical structure for inclusion in the model; we therefore also averaged the species population densities and ant densities at the multiple sites where each species occurred. To meet assumptions of normality in linear regression, we log-transformed the explanatory variables population density and body size, and included the response variable as log(impact score + 2). We started with a full model that included all of the main effects, plus all first order interactions between the four primary explanatory variables of interest. We simplified the model by backward elimination of the least significant variable, checking at each step that the model fit was not significantly diminished according to a partial F-test. We Selleck Panobinostat chose to keep the two variables that were not of primary interest (order and ant density) as main effects in the final model regardless of their significance since the purpose of their inclusion was to reveal the unique contributions of the other variables. For the rare species dataset, we constructed a logistic regression model with presence/absence in invaded plots as the binary categorical response variable, and included the categorical explanatory variables provenance and trophic Coproporphyrinogen III oxidase role

as well as the continuous explanatory variable body size. As in the non-rare species model, we included the variables ant density and order to control for these factors. For species that occurred at multiple sites, we scored a species as absent in invaded plots only if it was absent at all of the sites. We log-transformed the variable body size before inclusion in the model. We started with a full model that included all of the main effects, plus all first order interactions between the three primary explanatory variables of interest. We simplified the model through backward elimination of the least significant variable, checking at each step that the model fit was not significantly diminished according to the likelihood ratio test. All linear regressions were performed with Minitab v.

In our study, two members of the MMP family, MMP-14 and MMP-28, had increased expression resulting from HIF-1α overexpression in the in vitro microarray experiment and in the CAM experiments. The increased www.selleckchem.com/products/Neratinib(HKI-272).html expression of MMP-14 has been identified as a negative predictor of survival in SCLC [41], and the targeted drug inhibiting MMP-14 expression, marimastat [42], has been used in clinical studies. MMP-28 is expressed at low levels in normal lung tissue, but the expression of MMP-28 is highly increased after cancer formation [43]. MMP-28 induces epithelial-mesenchymal transitions (EMT), which yield tumor cells with collagen-invasive properties allowing the invasion of collagen matrices

[44]. The upregulation of MMP-28 by HIF-1α enhances this ability. The expression level of angiogenic factors is the gold standard to measure the angiogenic potential of tumors, and the inhibition of the expression of angiogenic factors is the primary treatment for SCLC. Angiogenic factors that are IWP-2 chemical structure significantly regulated by HIF-1α in a hypoxic find more microenvironment are also therapeutic target points [45]. In addition to VEGF, FGF-2 [46], ANG-2 [47], HIF-2α [48], and PDGFC are also involved in tumor angiogenesis. In this study, three inflammatory factors, IL-6, TNFAIP6, and IL1R1, were upregulated by HIF-1α. These inflammatory factors actively responded during the process of inflammatory

angiogenesis. TNFAIP6 is the stimulating factor for TNF-α [49], and IL-1R1 is the receptor for IL-1 [50]. IL-6 and VEGF-A have synergistic effects in stimulating the proliferation and invasiveness of tumors by promoting angiogenesis [51]. Our results indicate that HIF-1α may enhance the inflammatory reaction or stimulate

the secretion of coherent inflammatory factors to promote the angiogenesis of SCLC, which highlights the importance of anti-inflammation for the treatment of SCLC as some scholars have suggested [52]. In addition, the TNC, FN1, and HMOX1 cytokines were screen out by microarray analysis. TNC is an extracellular matrix protein with angiogenesis-promoting activities, check details and it has specific functions in vessel formation [53]. FN1 has been shown to be an angiogenic cytokine involved in angiogenesis during several pathological processes, such as psoriasis, diabetic retinopathy, and cancer [54]. The overexpression of HMOX1 has been observed in liver cancer [55], pancreatic cancer [56], and melanomas [57]. Targeting these cytokines for gene therapy of SCLC in the future requires their verification in clinical trials. Conclusions Overall, our results suggest that HIF-1α significantly promotes the growth and angiogenesis of NCI-H446 cells by upregulating the expression of angiogenic genes. Moreover, our use of the chick CAM as an in vivo experimental model further confirms the expression of these genes induced by HIF-1α.

The traditional practice of an interval appendectomy has been called into question by some, indicating that patients who do not have recurrent episodes of appendicitis within 3 to 6 months may never need an appendectomy[20].

Therefore, the clinician often wonders whether a patient with appendicitis needs to receive surgical treatment or to be managed with antibiotics. After a patient is diagnosed with appendicitis, clinician generally want to determine the severity before they can select the optimal treatment. If a clinician could predict the severity of appendicitis, one could determine the therapeutic CA-4948 method and the timing of the operation. A surgical indication marker such as the white blood cell count, neutrophil percentage or CRP would be useful for deciding between treating the patient with surgery or antibiotics. The aim of this study was to evaluate whether blood inflammatory markers predict the severity of appendicitis and to identify an independent marker for the surgical indication of acute appendicitis confirmed with clinical symptoms and other modalities. The current study showed that the

white blood cell AZD1390 cost counts and neutrophil percentage are not useful for surgical indication, whereas univariate analysis indicated that only CRP was significantly different between the surgery necessary group and unnecessary group, and multivariate analysis showed that only CRP was an independent marker for necrotic appendicitis. The ROC curve indicated that the optimal cutoff value of CRP for surgical indication for classifying cases was around 5 mg/dl. These data suggested that clinicians should consider the CRP level when selecting the treatment after the diagnosis of appendicitis. Our novel findings give additional information for surgical indication for appendicitis. Tideglusib mouse Numerous previous studies

have shown that the CRP level enhances the precision of diagnosis of acute appendicitis, but not surgical indication. A large retrospective study has documented that the sensitivity of CRP in these patients is greater than 90%[21]. Furthermore, the negative appendectomy rate is reduced by approximately 8% if surgery is cancels in patients with CRP levels and white blood cell counts within the reference range[22]. Another prospective study[11] aminophylline has shown that it is important to measure serial CRP levels and white blood cell counts in patients with suspected appendicitis. The sensitivity of CRP levels in predicting appendicitis was 60% on admission and increased to 100% by the fourth blood specimen. Conversely, white blood cell counts exhibited a sensitivity of 95% on admission, but dropped to 75% by the fourth specimen. Other studies[16, 23] confirm that an elevated CRP serves as a systemic marker of focal inflammation and infection. In this background, CRP and white blood cell counts are important for the diagnosis for appendicitis. After the diagnosis of appendicitis, the clinician must decide surgery or antibiotics.

Ganetespib cost albicans (Fig. 3A) and phylogenetic analysis revealed that Ahp of D. hansenii is more closely related to the yeast than to the plant or mammalian peroxiredoxins (Fig. 3B). Thus, DhAhp belongs to the alkyl hydroperoxide reductase of the peroxiredoxin family. Previously, Kurtzman and Robnett [29] have suggested that D. hansenii is phylogenetically related to C. albicans based on

the fact that they are both ascomycetous yeasts. The high similarity between the Ahps from both species further supports this notion. In addition, both organisms use an alternative genetic yeast code in which the CUG codon may be used as a serine codon [30]. Taken together, these results suggest that DhAhp and C. albicans Ahp11 have common ancestry, but show GSK1120212 solubility dmso divergent evolution. The closest structural homolog to DhAHP is the PrxD (Type Ii) of Populus tremula (PDB:1TP9A) (data not shown), which contains two cysteine residues. Though poplar Prx contains two conserved cysteine residues, it is assumed to function as a 1-Cys Prx because site-directed mutagenesis has demonstrated that only the catalytic cysteine of the poplar Prx is essential for hydroperoxide reduction [31]. Previously, the type II TPx from S. cerevisiae was reported to contain three Cys residues at positions 31, 62 and 120, and its disulfide linkage is between 62 and

120 and Cys-31 has no effect on TPx activity [32]. Though structural and sequence analyses of the deduced protein indicate that DhAhp contains 2 Cys residues at positions

24 and 54, the multiple sequence click here alignment of Ahps identifies the conserved Cys-54 as the peroxidative Glycogen branching enzyme cysteine (Fig. 3). The role of Cys-24 in D. hansenii Ahp remains to be explored in the future. Therefore, DhAhp is clearly a member of the disulfide oxidoreductases and can be considered a 1-Cys Prx. Regulation of expression of DhAHP Alkyl hydroperoxide reductases have been identified previously as oxidative stress proteins in Salmonella typhimurium [33] and Bacillus subtilis [23] and their expression is known to be upregulated by oxidative factors. However, the finding of an extensive accumulation of Ahp in the halophilic yeast D. hansenii by salt is reported for the first time in this study. Consistently, overexpression of D. hansenii Ahp in D. hansenii (Fig. 7) and in the two salt-sensitive yeasts S. cerevisiae and P. methanolica (Fig. 8 and 9) further increases their tolerance to salt. On the contrary, suppression of its expression in D. hansenii resulted in a lower tolerance to salinity (Fig. 6). Clearly, the results suggest that DhAHP is induced by salt and its expression confers the high salt tolerance in D. hansenii. A previous study also revealed that the expression of a homolog to the Escherichia coli Ahp is induced by osmotic shock in Staphylococcus aureus [34].

Positive but weak congruence between trees, and birds and bats is also found in the distribution of

endemic species. Lowland dipterocarp CB-839 molecular weight forest has the highest proportion of endemic tree species, for birds and bats this forest type ranks third in endemism following ultrabasic and montane forest. Whereas mangrove forest is still a relatively important forest type for endemic birds and bats, no endemic trees are found there. At country level, congruence between Philippine plant and vertebrate endemism as a proportion of global species richness is 100% (Myers et al. 2000), but our results show that there is much more heterogeneity in cross-taxon relations in endemic species richness at finer spatial scale levels. The distribution of globally AG-120 ic50 threatened species seems incongruent. Lowland dipterocarp forest has the highest relative occurrence of threatened tree species, whereas for birds and bats montane forest is the most important forest type in this respect. Within the two survey plots in lowland dipterocarp forest, nine endemic dipterocarp tree species were recorded that are listed as Critically Endangered

(Table 5), of these only two also occur in ultrabasic forest. Lowland dipterocarp and ultrabasic forest have comparable numbers this website of threatened tree species within the lower threat categories. In mangrove forest and montane forest no tree species listed as globally threatened

were recorded. No globally threatened birds were recorded in mangrove forest either but montane forest is an important forest type for threatened Erlotinib price birds. This is largely due to the fact that endemic montane species have small ranges and are thus more vulnerable to even small changes in montane forest cover (Brooks et al. 1999) and as a result qualify easier as threatened under the area change criteria of the IUCN Red List. Montane forest in the NSMNP has several enigmatic bird species, among which the Critically Endangered Philippine Eagle Pithecophaga jefferyi, the conservation icon of the Philippines. In this study, only one globally threatened species was recorded in mangrove forest, the Endangered fruit bat Acerodon jubatus. Cross-taxon congruence between the proportions of threatened trees and bats across the four forest types correlated negatively. It must be noted however that trees have not been completely assessed for the IUCN Red List, possibly explaining the lack of tree species classified as threatened in montane forest.

Redondo-Lopez V, Cook RL, Sobel JD: Emerging role of lactobacilli in the control and maintenance of the vaginal bacterial microflora. Rev CHIR98014 Infect Dis 1990,12(5):856–872.PubMedCrossRef 41. Vasquez A, Jakobsson T, Ahrne S, Forsum U, Molin G: Vaginal lactobacillus flora of healthy Swedish women. J Clin Microbiol 2002,40(8):2746–2749.PubMedCrossRef AZD2171 manufacturer 42. Hawes SE, Hillier SL, Benedetti J, Stevens CE, Koutsky LA, Wolner-Hanssen

P, Holmes KK: Hydrogen peroxide-producing lactobacilli and acquisition of vaginal infections. J Infect Dis 1996,174(5):1058–1063.PubMedCrossRef 43. Zheng HY, Alcorn TM, Cohen MS: Effects of H2O2-producing lactobacilli on Neisseria gonorrhoeae growth and catalase activity. J Infect Dis 1994,170(5):1209–1215.PubMedCrossRef 44. Klebanoff SJ, Coombs RW: Viricidal effect of Lactobacillus acidophilus on human immunodeficiency virus type 1: possible role in heterosexual transmission. J Exp Med 1991,174(1):289–292.PubMedCrossRef 45. Martin HL, Richardson BA, Nyange PM, Lavreys L, Hillier SL, Chohan B, Mandaliya K, Ndinya-Achola JO, Bwayo J, Kreiss J: Vaginal lactobacilli, microbial flora, and risk of human immunodeficiency virus type 1 and sexually transmitted disease acquisition. EPZ015666 molecular weight J Infect Dis

1999,180(6):1863–1868.PubMedCrossRef 46. Sha BE, Zariffard MR, Wang QJ, Chen HY, Bremer J, Cohen MH, Spear GT: Female genital-tract HIV load correlates inversely with Lactobacillus species but positively with bacterial vaginosis and Mycoplasma hominis. J Infect Dis O-methylated flavonoid 2005,191(1):25–32.PubMedCrossRef 47. Cu-Uvin S, Hogan JW, Caliendo AM, Harwell J, Mayer KH, Carpenter CC: Association between bacterial vaginosis and expression of human immunodeficiency virus type 1 RNA in the female genital tract. Clin Infect Dis 2001,33(6):894–896.PubMedCrossRef 48. Cherpes TL, Melan MA, Kant JA, Cosentino LA, Meyn LA, Hillier SL: Genital tract shedding of herpes simplex virus type 2 in women: effects of hormonal contraception, bacterial vaginosis, and vaginal group B Streptococcus colonization. Clin Infect Dis 2005,40(10):1422–1428.PubMedCrossRef 49. Taha TE, Hoover DR,

Dallabetta GA, Kumwenda NI, Mtimavalye LA, Yang LP, Liomba GN, Broadhead RL, Chiphangwi JD, Miotti PG: Bacterial vaginosis and disturbances of vaginal flora: association with increased acquisition of HIV. AIDS 1998,12(13):1699–1706.PubMedCrossRef 50. Wasserheit JN: Epidemiological synergy. Interrelationships between human immunodeficiency virus infection and other sexually transmitted diseases. Sex Transm Dis 1992,19(2):61–77.PubMed 51. Padian NS, Shiboski SC, Glass SO, Vittinghoff E: Heterosexual transmission of human immunodeficiency virus (HIV) in northern California: results from a ten-year study. Am J Epidemiol 1997,146(4):350–357.PubMedCrossRef 52. Tak PP, Firestein GS: NF-kappaB: a key role in inflammatory diseases. J Clin Invest 2001,107(1):7–11.PubMedCrossRef 53. Lawrence T, Gilroy DW, Colville-Nash PR, Willoughby DA: Possible new role for NF-kappaB in the resolution of inflammation.

From this total of 44 genes, only six showed significant correlations to morphological characteristics. Ribosomal RNA genes were the main class of genes exhibiting conserved gene copies that were significantly correlated to the

cyanobacterial sections IV and V. Species capable of terminal cell differentiation exhibited four or five copies of ribosomal genes. Furthermore, Gloebacter violaceus and a thermophilic Synechococcus species share a distinct pattern of gene copy numbers which adds independent support to previous studies that have grouped these species separately from the rest of cyanobacteria, closer to an eubacterial outgroup [22, 35–39]. We investigated click here conserved gene copies that exhibited ≥90%(not shown), ≥95%(not shown) and ≥98% amino acid sequence identity within a genome. Results varied mainly in numbers of transposase gene copies detected. Therefore, results of gene copies with an

identity of ≥98%within a genome and ≥50%between species are presented here. For these genes, we mapped copy numbers in relation to the phylogenetic position within cyanobacteria (Figure 1). The highest number of gene copies (24) was found for a transposase encoding gene in Microcystis aeruginosa. Transposases are enzymes that catalyze the movement of transposable https://www.selleckchem.com/products/SB-203580.html elements. Previous studies have estimated that genes encoding for transposases are the most widespread genes, and often occur as multiple copies [40]. Almost half of the conserved gene copies identified in this study were transposase encoding

Reverse transcriptase genes. The frequency of transposase genes varied between different species. Microcystis aeruginosa possessed various transposase genes, whereas strains belonging to the genera Synechococcus and Prochlorococcus, and Cyanobacterium sp. UCYN-A seem to exhibited fewer transposase gene copies. Figure 1 Conserved paralogs in cyanobacteria. Distribution of gene copy numbers within and across cyanobacterial genomes. On the left side cyanobacterial cladogram is shown, emphasizing the different morphological groups. Species of group G1 exhibiting circadian rhythm are displayed in a yellow box. Trichodesmium exhibiting reversible differentiation is shown in a green box (group G2) and cyanobacteria of group G3 which are able to terminally differentiate, are displayed in a blue box. The letter ‘N’ marks species capable of nitrogen fixation. Conserved copy numbers of genes are shown in a color plot ranging from yellow selleck chemicals llc indicating a single gene to dark red denoting 8 copies or more. In cases where gene copy numbers exceed 8, values are given in white letters. Corresponding species names are written on the left and gene names are written on top. Copy numbers of genes displayed in bold and marked by a “*” are positively correlated to terminal differentiation. Synechococcus sp.

e. down regulates several host responses) in comparison to the ubiquitous serovars [39]. The lower cytotoxicity and lack of IL-6 responses support this assumption. In contrast to the role in IL-6 induction, none of the mutants differed significantly from the wild type strains in induction of oxidative responses. This result suggested that flagellin was not important for induction of the oxidative response. Results on the role

of flagella and chemotaxis genes in Salmonella host pathogen interaction have been contradictory (compare [12] and [8] with [11]), and we purposely looked for a sensitive assay to show subtle differences between strains. Co-infection assays have been shown to be more sensitive than assays where strains are tested individually [40]. Using see more this assay, we found that flagella significantly MK-4827 supplier influenced the number of bacteria that could be isolated from the spleen 4–5 days post oral infection of mice with S. Dublin, but not with S. Typhimurium. Chemotaxis genes were found to be dispensable in this assay, as previously reported for S. Typhimurium [11]. Animal welfare regulations dictated us to scarify mice when they were severely affected by infection, and this prevented us from using one single end-point of infection. Potentially, this may have influenced the competitive indexes for S. Typhimurium, since this serovar propagated at different speed at systemic sites depending

on the presence of flagella genes (see below). However, all mice were killed within a 24 hours period, and we do not believe that this significantly influenced our results. Like cheA mutation, mutation of cheR check details confers a constitutively smooth swimming phenotype. We have not included this gene in our investigation, and we cannot rule out that it may have a different role in host pathogen interaction than cheA. We have performed preliminary testing of an S. Dublin cheR mutant and found that it corresponds to cheA with respect to phenotypes in cell assays and oral challenge of mice (unpublished), however, we do not have S. Typhimurium results to compare it

to. Flagella have been found to be important for the outcome of oral infection with S. Typhimurium in streptomycin treated mice, which is a model for studies of the entero-pahtogenesis of Salmonella[41]. In this model flagella Venetoclax are essential for initiation of inflammation, creating an environment in which Salmonella prevails over the normal flora, and in this model, chemotaxis genes were also essential for the outcome of infection. Cattle are the natural host for S. Dublin, and in addition to differences caused by the choice of animal model, studies have shown that virulence factors may differ depending on the host [42]. This must be taken into account when concluding on the current results. The changes in virulence observed when flagella were removed were relatively modest.